Incidental Mutation 'R6088:Lamp3'
ID486115
Institutional Source Beutler Lab
Gene Symbol Lamp3
Ensembl Gene ENSMUSG00000041247
Gene Namelysosomal-associated membrane protein 3
SynonymsCd208, DC-LAMP, 1200002D17Rik, TSC403
MMRRC Submission 044245-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6088 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location19653378-19706375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19673398 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 365 (F365L)
Ref Sequence ENSEMBL: ENSMUSP00000080556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081880]
Predicted Effect probably damaging
Transcript: ENSMUST00000081880
AA Change: F365L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080556
Gene: ENSMUSG00000041247
AA Change: F365L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Lamp 103 411 5.6e-75 PFAM
Meta Mutation Damage Score 0.7567 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dendritic cells (DCs) are the most potent antigen-presenting cells. Immature DCs efficiently capture antigens and differentiate into interdigitating dendritic cells (IDCs) in lymphoid tissues that induce primary T-cell responses (summary by de Saint-Vis et al., 1998 [PubMed 9768752]).[supplied by OMIM, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,902,102 V360F probably damaging Het
Ankrd17 C T 5: 90,253,688 E1605K possibly damaging Het
Arid4a A G 12: 71,022,236 D54G probably damaging Het
Baz2a TCTCCTC TCTC 10: 128,114,642 probably benign Het
Card6 A T 15: 5,105,019 V234E possibly damaging Het
Cd1d1 G T 3: 86,998,702 Q89K probably benign Het
Ciita G A 16: 10,511,931 R693K probably damaging Het
Cox7a2l G T 17: 83,503,972 L77I probably benign Het
Crybg2 A T 4: 134,075,790 probably null Het
Cts8 T C 13: 61,253,966 N39S probably benign Het
Def8 G T 8: 123,460,048 E456* probably null Het
Dld A G 12: 31,340,989 F153L probably benign Het
Elf1 C T 14: 79,567,261 T122I probably benign Het
Emilin2 T C 17: 71,255,124 N961S probably benign Het
Esp24 A G 17: 39,040,010 I34V probably benign Het
Fam129b T C 2: 32,923,123 V540A probably damaging Het
Fam184b C A 5: 45,584,012 K292N probably damaging Het
Gabrg3 T A 7: 56,985,078 N119I probably damaging Het
Gucy1b1 T C 3: 82,034,880 H524R probably damaging Het
Kcp A T 6: 29,502,632 S205T probably benign Het
Klb C T 5: 65,349,013 T201M probably benign Het
Mad1l1 T A 5: 140,193,963 H390L probably benign Het
Mlxipl T C 5: 135,134,030 Y711H possibly damaging Het
Myo5b T A 18: 74,720,898 L1196Q possibly damaging Het
Ndufb8 A G 19: 44,555,025 S70P probably benign Het
Neb T C 2: 52,209,342 D4832G probably damaging Het
Nr5a1 T C 2: 38,701,995 D322G probably benign Het
Olfr396-ps1 A T 11: 73,928,823 T273S probably benign Het
Olfr988 T A 2: 85,353,354 S191C probably damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Oxa1l T A 14: 54,367,694 probably null Het
Pafah2 A G 4: 134,413,381 I221V probably benign Het
Pibf1 T A 14: 99,179,358 F456I probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekhg2 C T 7: 28,361,013 V964I probably benign Het
Ppip5k1 C A 2: 121,337,463 V770L probably benign Het
Ppl A T 16: 5,104,988 L213Q possibly damaging Het
Ptprf G A 4: 118,210,755 T1785I possibly damaging Het
Pycr2 G A 1: 180,906,236 G131E probably damaging Het
Rbpj C T 5: 53,651,368 probably null Het
Rcc1 G T 4: 132,332,842 D430E probably benign Het
Rhbdf1 A G 11: 32,212,007 V525A possibly damaging Het
Samd7 G A 3: 30,756,483 M216I probably benign Het
Ska3 A T 14: 57,816,694 D266E probably benign Het
Slc1a7 G A 4: 108,012,444 V569M probably damaging Het
Slc26a1 C T 5: 108,674,006 E6K possibly damaging Het
Slc4a4 T A 5: 89,197,704 V741E probably benign Het
St6galnac3 C T 3: 153,206,715 G164S probably damaging Het
Tgs1 T A 4: 3,595,383 N517K probably benign Het
Tns4 A G 11: 99,073,720 S522P probably damaging Het
Trpm1 A T 7: 64,267,976 M355L probably damaging Het
Trpm8 G A 1: 88,306,678 probably benign Het
Uhrf1bp1 G A 17: 27,884,605 probably null Het
V1ra8 T C 6: 90,203,100 F95S probably damaging Het
Zfp521 A C 18: 13,846,109 S416A possibly damaging Het
Zfp574 T A 7: 25,080,339 V262E probably benign Het
Zfp740 T A 15: 102,208,808 I77N probably damaging Het
Zscan18 A T 7: 12,775,198 probably benign Het
Other mutations in Lamp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Lamp3 APN 16 19673419 missense probably damaging 1.00
IGL02505:Lamp3 APN 16 19655457 missense possibly damaging 0.48
IGL02892:Lamp3 APN 16 19676052 missense probably damaging 1.00
IGL03228:Lamp3 APN 16 19676067 missense possibly damaging 0.94
PIT4453001:Lamp3 UTSW 16 19673460 missense probably benign 0.14
R0295:Lamp3 UTSW 16 19701108 nonsense probably null
R0419:Lamp3 UTSW 16 19673552 missense probably damaging 1.00
R1568:Lamp3 UTSW 16 19673525 missense probably damaging 1.00
R1702:Lamp3 UTSW 16 19676072 missense probably benign 0.11
R2018:Lamp3 UTSW 16 19701211 missense probably benign 0.02
R2019:Lamp3 UTSW 16 19701211 missense probably benign 0.02
R4072:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4073:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4075:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4076:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4333:Lamp3 UTSW 16 19673436 missense probably benign 0.02
R4457:Lamp3 UTSW 16 19673529 missense probably benign 0.19
R4868:Lamp3 UTSW 16 19701290 missense probably benign 0.01
R4876:Lamp3 UTSW 16 19655470 missense probably damaging 0.97
R5766:Lamp3 UTSW 16 19701317 missense probably damaging 0.99
R5832:Lamp3 UTSW 16 19701320 missense probably damaging 0.98
R5997:Lamp3 UTSW 16 19701028 missense probably benign 0.22
R6000:Lamp3 UTSW 16 19700948 missense possibly damaging 0.88
R6332:Lamp3 UTSW 16 19699681 missense probably damaging 1.00
R6636:Lamp3 UTSW 16 19701233 missense probably benign
R6637:Lamp3 UTSW 16 19701233 missense probably benign
R6881:Lamp3 UTSW 16 19699618 missense probably benign 0.39
R6966:Lamp3 UTSW 16 19699653 nonsense probably null
R7002:Lamp3 UTSW 16 19655422 missense possibly damaging 0.89
R7067:Lamp3 UTSW 16 19699663 missense probably damaging 0.99
R7425:Lamp3 UTSW 16 19699612 critical splice donor site probably null
R7781:Lamp3 UTSW 16 19699690 missense possibly damaging 0.86
R7866:Lamp3 UTSW 16 19699740 missense probably benign 0.01
R7894:Lamp3 UTSW 16 19655391 missense probably damaging 1.00
R7912:Lamp3 UTSW 16 19655497 missense probably damaging 1.00
R7949:Lamp3 UTSW 16 19699740 missense probably benign 0.01
R7977:Lamp3 UTSW 16 19655391 missense probably damaging 1.00
R7993:Lamp3 UTSW 16 19655497 missense probably damaging 1.00
R8036:Lamp3 UTSW 16 19701059 missense probably damaging 1.00
RF018:Lamp3 UTSW 16 19701250 missense probably benign
X0025:Lamp3 UTSW 16 19701056 missense possibly damaging 0.82
X0063:Lamp3 UTSW 16 19700885 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACATGTAAGCATAGGGTGAGTAC -3'
(R):5'- ATAGTAGTGGCACCTGGAACTC -3'

Sequencing Primer
(F):5'- GGTGAGTACAGCCCTTAAAACTTC -3'
(R):5'- GGCACCTGGAACTCAATTAATATTG -3'
Posted On2017-08-16