Incidental Mutation 'R6090:Olfr141'
ID486128
Institutional Source Beutler Lab
Gene Symbol Olfr141
Ensembl Gene ENSMUSG00000078420
Gene Nameolfactory receptor 141
SynonymsK17, MOR179-5, GA_x6K02T2Q125-48299679-48298702
MMRRC Submission 044247-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6090 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86804134-86810018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86806357 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 214 (V214G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000216117]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105212
AA Change: V214G

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100847
Gene: ENSMUSG00000078420
AA Change: V214G

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.3e-48 PFAM
Pfam:7tm_1 39 288 2.7e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216117
AA Change: V214G

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,648,013 A450V probably benign Het
Abca8a T C 11: 110,063,222 probably null Het
Adgrl3 A T 5: 81,512,326 N246I probably damaging Het
Arntl2 T A 6: 146,829,696 S500T possibly damaging Het
Cdipt A T 7: 126,976,959 M29L possibly damaging Het
Chml G T 1: 175,687,058 Y432* probably null Het
Clasp2 G T 9: 113,852,735 V320L probably benign Het
Col12a1 G A 9: 79,692,393 T826M probably damaging Het
Cpsf3 A G 12: 21,295,193 I169V probably damaging Het
Dhx36 G A 3: 62,496,820 T234M probably damaging Het
Dhx57 A G 17: 80,263,946 probably null Het
Dnah1 A T 14: 31,269,425 I3132N possibly damaging Het
Fbxw20 G T 9: 109,223,363 Q231K probably benign Het
Gfod1 G T 13: 43,200,961 Y179* probably null Het
Glg1 T A 8: 111,181,035 I510F probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gse1 C A 8: 120,571,169 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Klrd1 T C 6: 129,595,536 L97P probably damaging Het
Lgmn A T 12: 102,400,154 M240K probably damaging Het
Lrp1b A G 2: 41,185,868 probably null Het
Notch2 A T 3: 98,135,377 R1353* probably null Het
Olfr715b A G 7: 107,106,249 V204A possibly damaging Het
Pcdhb14 G A 18: 37,448,606 S255N probably benign Het
Pcgf2 C T 11: 97,690,991 M25I possibly damaging Het
Poll G T 19: 45,555,997 D328E probably benign Het
Pomgnt2 A T 9: 121,982,797 L306Q probably damaging Het
Proser1 A T 3: 53,478,667 M657L probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Rdh11 G T 12: 79,189,064 P37T probably benign Het
Rsph10b A T 5: 143,977,128 I286L probably benign Het
Sept4 G A 11: 87,589,517 R238K possibly damaging Het
Sptan1 C T 2: 29,993,887 R580C probably damaging Het
Stard9 T A 2: 120,693,654 W777R probably damaging Het
Timd2 T C 11: 46,687,236 T23A probably benign Het
Tmc4 A G 7: 3,671,053 Y376H probably damaging Het
Tmem143 A G 7: 45,909,526 I297M probably benign Het
Togaram1 A G 12: 64,967,801 T609A probably benign Het
Tyw3 T C 3: 154,597,067 H10R probably benign Het
Unc13b C A 4: 43,239,306 H3456Q probably damaging Het
Zfp131 A T 13: 119,775,996 H275Q probably damaging Het
Other mutations in Olfr141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Olfr141 APN 2 86806425 nonsense probably null
R0400:Olfr141 UTSW 2 86806651 missense probably damaging 1.00
R0609:Olfr141 UTSW 2 86806861 missense probably damaging 0.98
R1650:Olfr141 UTSW 2 86806747 missense possibly damaging 0.62
R1918:Olfr141 UTSW 2 86806827 missense probably damaging 1.00
R3975:Olfr141 UTSW 2 86806460 missense possibly damaging 0.95
R4567:Olfr141 UTSW 2 86806802 missense probably damaging 0.99
R7286:Olfr141 UTSW 2 86806623 missense possibly damaging 0.62
R7910:Olfr141 UTSW 2 86806847 missense probably benign 0.00
R8048:Olfr141 UTSW 2 86806171 missense probably damaging 0.99
R8193:Olfr141 UTSW 2 86806865 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- TCTCAGACTGTAGATGATGGGG -3'
(R):5'- ACACAGTGGCCACTTTCAG -3'

Sequencing Primer
(F):5'- GGTTGAGCATGGGAATCCC -3'
(R):5'- GGCCACTTTCAGCCTGTC -3'
Posted On2017-08-16