Incidental Mutation 'R6090:Gm10801'
ID486129
Institutional Source Beutler Lab
Gene Symbol Gm10801
Ensembl Gene ENSMUSG00000075015
Gene Namepredicted gene 10801
Synonyms
MMRRC Submission 044247-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R6090 (G1)
Quality Score134.467
Status Not validated
Chromosome2
Chromosomal Location98662237-98664083 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) TC to TCGGC at 98663806 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099683] [ENSMUST00000099684]
Predicted Effect probably benign
Transcript: ENSMUST00000099683
SMART Domains Protein: ENSMUSP00000097275
Gene: ENSMUSG00000075014

DomainStartEndE-ValueType
internal_repeat_1 1 41 1.13e-5 PROSPERO
internal_repeat_2 26 49 4.11e-5 PROSPERO
transmembrane domain 78 96 N/A INTRINSIC
internal_repeat_1 114 174 1.13e-5 PROSPERO
low complexity region 177 188 N/A INTRINSIC
internal_repeat_2 197 219 4.11e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000099684
SMART Domains Protein: ENSMUSP00000097276
Gene: ENSMUSG00000075015

DomainStartEndE-ValueType
internal_repeat_1 2 73 1.19e-13 PROSPERO
internal_repeat_1 80 167 1.19e-13 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,648,013 A450V probably benign Het
Abca8a T C 11: 110,063,222 probably null Het
Adgrl3 A T 5: 81,512,326 N246I probably damaging Het
Arntl2 T A 6: 146,829,696 S500T possibly damaging Het
Cdipt A T 7: 126,976,959 M29L possibly damaging Het
Chml G T 1: 175,687,058 Y432* probably null Het
Clasp2 G T 9: 113,852,735 V320L probably benign Het
Col12a1 G A 9: 79,692,393 T826M probably damaging Het
Cpsf3 A G 12: 21,295,193 I169V probably damaging Het
Dhx36 G A 3: 62,496,820 T234M probably damaging Het
Dhx57 A G 17: 80,263,946 probably null Het
Dnah1 A T 14: 31,269,425 I3132N possibly damaging Het
Fbxw20 G T 9: 109,223,363 Q231K probably benign Het
Gfod1 G T 13: 43,200,961 Y179* probably null Het
Glg1 T A 8: 111,181,035 I510F probably damaging Het
Gse1 C A 8: 120,571,169 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Klrd1 T C 6: 129,595,536 L97P probably damaging Het
Lgmn A T 12: 102,400,154 M240K probably damaging Het
Lrp1b A G 2: 41,185,868 probably null Het
Notch2 A T 3: 98,135,377 R1353* probably null Het
Olfr141 A C 2: 86,806,357 V214G possibly damaging Het
Olfr715b A G 7: 107,106,249 V204A possibly damaging Het
Pcdhb14 G A 18: 37,448,606 S255N probably benign Het
Pcgf2 C T 11: 97,690,991 M25I possibly damaging Het
Poll G T 19: 45,555,997 D328E probably benign Het
Pomgnt2 A T 9: 121,982,797 L306Q probably damaging Het
Proser1 A T 3: 53,478,667 M657L probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Rdh11 G T 12: 79,189,064 P37T probably benign Het
Rsph10b A T 5: 143,977,128 I286L probably benign Het
Sept4 G A 11: 87,589,517 R238K possibly damaging Het
Sptan1 C T 2: 29,993,887 R580C probably damaging Het
Stard9 T A 2: 120,693,654 W777R probably damaging Het
Timd2 T C 11: 46,687,236 T23A probably benign Het
Tmc4 A G 7: 3,671,053 Y376H probably damaging Het
Tmem143 A G 7: 45,909,526 I297M probably benign Het
Togaram1 A G 12: 64,967,801 T609A probably benign Het
Tyw3 T C 3: 154,597,067 H10R probably benign Het
Unc13b C A 4: 43,239,306 H3456Q probably damaging Het
Zfp131 A T 13: 119,775,996 H275Q probably damaging Het
Other mutations in Gm10801
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Gm10801 APN 2 98663983 missense probably benign
IGL01154:Gm10801 APN 2 98663983 missense probably benign
PIT4131001:Gm10801 UTSW 2 98662303 missense probably benign
PIT4142001:Gm10801 UTSW 2 98662303 missense probably benign
R0026:Gm10801 UTSW 2 98663909 splice site probably benign
R0063:Gm10801 UTSW 2 98663840 missense probably benign 0.30
R0334:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R0335:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R1172:Gm10801 UTSW 2 98663907 splice site probably benign
R1321:Gm10801 UTSW 2 98663907 splice site probably benign
R1871:Gm10801 UTSW 2 98663840 missense probably benign 0.30
R1924:Gm10801 UTSW 2 98663852 missense probably damaging 1.00
R2163:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R2306:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R2379:Gm10801 UTSW 2 98663840 missense probably benign 0.30
R3078:Gm10801 UTSW 2 98663852 missense probably damaging 1.00
R3605:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R3892:Gm10801 UTSW 2 98663901 splice site probably null
R3930:Gm10801 UTSW 2 98664016 missense possibly damaging 0.48
R4638:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R4709:Gm10801 UTSW 2 98663901 splice site probably null
R5390:Gm10801 UTSW 2 98663806 small insertion probably benign
R5405:Gm10801 UTSW 2 98663806 small insertion probably benign
R5535:Gm10801 UTSW 2 98662499 frame shift probably null
R5653:Gm10801 UTSW 2 98664051 missense probably damaging 1.00
R5747:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R5987:Gm10801 UTSW 2 98663807 nonsense probably null
R6086:Gm10801 UTSW 2 98663803 nonsense probably null
R6093:Gm10801 UTSW 2 98663807 nonsense probably null
R6112:Gm10801 UTSW 2 98664064 missense probably benign 0.00
R6184:Gm10801 UTSW 2 98663806 small insertion probably benign
R6352:Gm10801 UTSW 2 98663806 small insertion probably benign
R6357:Gm10801 UTSW 2 98663807 frame shift probably null
R6395:Gm10801 UTSW 2 98663807 small insertion probably benign
R6514:Gm10801 UTSW 2 98663869 missense probably benign 0.19
R6547:Gm10801 UTSW 2 98663803 nonsense probably null
R6560:Gm10801 UTSW 2 98663807 nonsense probably null
R6640:Gm10801 UTSW 2 98663807 nonsense probably null
R6675:Gm10801 UTSW 2 98663806 small insertion probably benign
R6679:Gm10801 UTSW 2 98663806 small insertion probably benign
R6684:Gm10801 UTSW 2 98663807 nonsense probably null
R6758:Gm10801 UTSW 2 98663807 nonsense probably null
R6786:Gm10801 UTSW 2 98663803 nonsense probably null
R6886:Gm10801 UTSW 2 98663806 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATCTGTGTAGAAAGCTGTTGCTC -3'
(R):5'- CTTTCTCTAGCCCCGGAAAC -3'

Sequencing Primer
(F):5'- TGGCTCAATGGCAGAGTGC -3'
(R):5'- ATGCACACTGTAAGACCTGG -3'
Posted On2017-08-16