Mutagenetix > Incidental Mutations

Incidental Mutation 'R6090:Proser1'

486131

Institutional Source

Beutler Lab

Gene Symbol

Proser1

Ensembl Gene

ENSMUSG00000049504

Gene Name

proline and serine rich 1

Synonyms

2810046L04Rik

MMRRC Submission

044247-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6090 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53463666-53481755 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53478667 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 657 (M657L)

Ref Sequence

ENSEMBL: ENSMUSP00000055253 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058577]

Predicted Effect

probably benign
Transcript: ENSMUST00000058577
AA Change: M657L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000055253
Gene: ENSMUSG00000049504
AA Change: M657L

Domain	Start	End	E-Value	Type
Pfam:DUF4476	1	63	5e-12	PFAM
Pfam:DUF4476	30	121	4e-27	PFAM
low complexity region	227	246	N/A	INTRINSIC
low complexity region	276	297	N/A	INTRINSIC
low complexity region	302	316	N/A	INTRINSIC
low complexity region	321	331	N/A	INTRINSIC
low complexity region	335	357	N/A	INTRINSIC
low complexity region	399	412	N/A	INTRINSIC
low complexity region	696	718	N/A	INTRINSIC
low complexity region	781	804	N/A	INTRINSIC
low complexity region	806	817	N/A	INTRINSIC
low complexity region	820	834	N/A	INTRINSIC
low complexity region	854	880	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200328

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein containing proline and serine rich regions. These regions may be important in protein-protein interactions. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	C	T	6: 121,648,013	A450V	probably benign	Het
Abca8a	T	C	11: 110,063,222		probably null	Het
Adgrl3	A	T	5: 81,512,326	N246I	probably damaging	Het
Arntl2	T	A	6: 146,829,696	S500T	possibly damaging	Het
Cdipt	A	T	7: 126,976,959	M29L	possibly damaging	Het
Chml	G	T	1: 175,687,058	Y432*	probably null	Het
Clasp2	G	T	9: 113,852,735	V320L	probably benign	Het
Col12a1	G	A	9: 79,692,393	T826M	probably damaging	Het
Cpsf3	A	G	12: 21,295,193	I169V	probably damaging	Het
Dhx36	G	A	3: 62,496,820	T234M	probably damaging	Het
Dhx57	A	G	17: 80,263,946		probably null	Het
Dnah1	A	T	14: 31,269,425	I3132N	possibly damaging	Het
Fbxw20	G	T	9: 109,223,363	Q231K	probably benign	Het
Gfod1	G	T	13: 43,200,961	Y179*	probably null	Het
Glg1	T	A	8: 111,181,035	I510F	probably damaging	Het
Gm10801	TC	TCGGC	2: 98,663,806		probably benign	Het
Gse1	C	A	8: 120,571,169		probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Klrd1	T	C	6: 129,595,536	L97P	probably damaging	Het
Lgmn	A	T	12: 102,400,154	M240K	probably damaging	Het
Lrp1b	A	G	2: 41,185,868		probably null	Het
Notch2	A	T	3: 98,135,377	R1353*	probably null	Het
Olfr141	A	C	2: 86,806,357	V214G	possibly damaging	Het
Olfr715b	A	G	7: 107,106,249	V204A	possibly damaging	Het
Pcdhb14	G	A	18: 37,448,606	S255N	probably benign	Het
Pcgf2	C	T	11: 97,690,991	M25I	possibly damaging	Het
Poll	G	T	19: 45,555,997	D328E	probably benign	Het
Pomgnt2	A	T	9: 121,982,797	L306Q	probably damaging	Het
Rbm47	G	C	5: 66,026,283	R326G	probably damaging	Het
Rdh11	G	T	12: 79,189,064	P37T	probably benign	Het
Rsph10b	A	T	5: 143,977,128	I286L	probably benign	Het
Sept4	G	A	11: 87,589,517	R238K	possibly damaging	Het
Sptan1	C	T	2: 29,993,887	R580C	probably damaging	Het
Stard9	T	A	2: 120,693,654	W777R	probably damaging	Het
Timd2	T	C	11: 46,687,236	T23A	probably benign	Het
Tmc4	A	G	7: 3,671,053	Y376H	probably damaging	Het
Tmem143	A	G	7: 45,909,526	I297M	probably benign	Het
Togaram1	A	G	12: 64,967,801	T609A	probably benign	Het
Tyw3	T	C	3: 154,597,067	H10R	probably benign	Het
Unc13b	C	A	4: 43,239,306	H3456Q	probably damaging	Het
Zfp131	A	T	13: 119,775,996	H275Q	probably damaging	Het

Other mutations in Proser1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02035:Proser1	APN	3	53478830	missense	probably benign	0.00
IGL02217:Proser1	APN	3	53471491	missense	probably damaging	0.96
IGL02260:Proser1	APN	3	53478944	missense	probably damaging	1.00
IGL02943:Proser1	APN	3	53479103	missense	probably damaging	0.98
donatello	UTSW	3	53467151	missense	probably damaging	1.00
R0166:Proser1	UTSW	3	53480617	missense	possibly damaging	0.89
R0230:Proser1	UTSW	3	53478962	missense	probably damaging	0.99
R0579:Proser1	UTSW	3	53467151	missense	probably damaging	1.00
R0599:Proser1	UTSW	3	53479064	missense	probably benign	0.04
R0616:Proser1	UTSW	3	53474697	missense	probably damaging	0.98
R0622:Proser1	UTSW	3	53477860	missense	probably benign	0.22
R0629:Proser1	UTSW	3	53479064	missense	probably benign	0.04
R0707:Proser1	UTSW	3	53478776	missense	probably damaging	1.00
R1568:Proser1	UTSW	3	53477759	missense	possibly damaging	0.54
R1997:Proser1	UTSW	3	53478871	missense	probably benign	0.10
R2129:Proser1	UTSW	3	53477945	missense	probably benign	0.20
R2207:Proser1	UTSW	3	53478391	missense	probably benign	0.00
R2851:Proser1	UTSW	3	53480545	missense	probably benign	0.07
R4077:Proser1	UTSW	3	53478541	missense	probably damaging	1.00
R4093:Proser1	UTSW	3	53479712	critical splice donor site	probably null
R4970:Proser1	UTSW	3	53464306	missense	probably damaging	1.00
R4988:Proser1	UTSW	3	53479625	missense	probably damaging	0.98
R5611:Proser1	UTSW	3	53478875	missense	probably benign	0.10
R6146:Proser1	UTSW	3	53478119	missense	probably damaging	1.00
R6459:Proser1	UTSW	3	53478329	missense	possibly damaging	0.51
R6880:Proser1	UTSW	3	53477839	missense	probably benign
R7308:Proser1	UTSW	3	53478704	missense	probably benign	0.40
R7456:Proser1	UTSW	3	53478518	missense	probably damaging	0.99
R7787:Proser1	UTSW	3	53473548	missense	probably damaging	1.00
R7903:Proser1	UTSW	3	53479082	nonsense	probably null
R8108:Proser1	UTSW	3	53472088	critical splice donor site	probably null
R8172:Proser1	UTSW	3	53478851	missense	possibly damaging	0.73
R8414:Proser1	UTSW	3	53478556	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGCTCACTTTTGCACG -3'
(R):5'- AGGGTGTACAGCTGCAGATG -3'

Sequencing Primer
(F):5'- TGCCCGTTATGATAAAAAGTGAGCC -3'
(R):5'- ACAGCTGCAGATGTGGTG -3'

Posted On

2017-08-16