Incidental Mutation 'R6090:Proser1'
ID486131
Institutional Source Beutler Lab
Gene Symbol Proser1
Ensembl Gene ENSMUSG00000049504
Gene Nameproline and serine rich 1
Synonyms2810046L04Rik
MMRRC Submission 044247-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6090 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location53463666-53481755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53478667 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 657 (M657L)
Ref Sequence ENSEMBL: ENSMUSP00000055253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058577]
Predicted Effect probably benign
Transcript: ENSMUST00000058577
AA Change: M657L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055253
Gene: ENSMUSG00000049504
AA Change: M657L

DomainStartEndE-ValueType
Pfam:DUF4476 1 63 5e-12 PFAM
Pfam:DUF4476 30 121 4e-27 PFAM
low complexity region 227 246 N/A INTRINSIC
low complexity region 276 297 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
low complexity region 321 331 N/A INTRINSIC
low complexity region 335 357 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 696 718 N/A INTRINSIC
low complexity region 781 804 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 820 834 N/A INTRINSIC
low complexity region 854 880 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200328
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein containing proline and serine rich regions. These regions may be important in protein-protein interactions. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,648,013 A450V probably benign Het
Abca8a T C 11: 110,063,222 probably null Het
Adgrl3 A T 5: 81,512,326 N246I probably damaging Het
Arntl2 T A 6: 146,829,696 S500T possibly damaging Het
Cdipt A T 7: 126,976,959 M29L possibly damaging Het
Chml G T 1: 175,687,058 Y432* probably null Het
Clasp2 G T 9: 113,852,735 V320L probably benign Het
Col12a1 G A 9: 79,692,393 T826M probably damaging Het
Cpsf3 A G 12: 21,295,193 I169V probably damaging Het
Dhx36 G A 3: 62,496,820 T234M probably damaging Het
Dhx57 A G 17: 80,263,946 probably null Het
Dnah1 A T 14: 31,269,425 I3132N possibly damaging Het
Fbxw20 G T 9: 109,223,363 Q231K probably benign Het
Gfod1 G T 13: 43,200,961 Y179* probably null Het
Glg1 T A 8: 111,181,035 I510F probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gse1 C A 8: 120,571,169 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Klrd1 T C 6: 129,595,536 L97P probably damaging Het
Lgmn A T 12: 102,400,154 M240K probably damaging Het
Lrp1b A G 2: 41,185,868 probably null Het
Notch2 A T 3: 98,135,377 R1353* probably null Het
Olfr141 A C 2: 86,806,357 V214G possibly damaging Het
Olfr715b A G 7: 107,106,249 V204A possibly damaging Het
Pcdhb14 G A 18: 37,448,606 S255N probably benign Het
Pcgf2 C T 11: 97,690,991 M25I possibly damaging Het
Poll G T 19: 45,555,997 D328E probably benign Het
Pomgnt2 A T 9: 121,982,797 L306Q probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Rdh11 G T 12: 79,189,064 P37T probably benign Het
Rsph10b A T 5: 143,977,128 I286L probably benign Het
Sept4 G A 11: 87,589,517 R238K possibly damaging Het
Sptan1 C T 2: 29,993,887 R580C probably damaging Het
Stard9 T A 2: 120,693,654 W777R probably damaging Het
Timd2 T C 11: 46,687,236 T23A probably benign Het
Tmc4 A G 7: 3,671,053 Y376H probably damaging Het
Tmem143 A G 7: 45,909,526 I297M probably benign Het
Togaram1 A G 12: 64,967,801 T609A probably benign Het
Tyw3 T C 3: 154,597,067 H10R probably benign Het
Unc13b C A 4: 43,239,306 H3456Q probably damaging Het
Zfp131 A T 13: 119,775,996 H275Q probably damaging Het
Other mutations in Proser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02035:Proser1 APN 3 53478830 missense probably benign 0.00
IGL02217:Proser1 APN 3 53471491 missense probably damaging 0.96
IGL02260:Proser1 APN 3 53478944 missense probably damaging 1.00
IGL02943:Proser1 APN 3 53479103 missense probably damaging 0.98
donatello UTSW 3 53467151 missense probably damaging 1.00
R0166:Proser1 UTSW 3 53480617 missense possibly damaging 0.89
R0230:Proser1 UTSW 3 53478962 missense probably damaging 0.99
R0579:Proser1 UTSW 3 53467151 missense probably damaging 1.00
R0599:Proser1 UTSW 3 53479064 missense probably benign 0.04
R0616:Proser1 UTSW 3 53474697 missense probably damaging 0.98
R0622:Proser1 UTSW 3 53477860 missense probably benign 0.22
R0629:Proser1 UTSW 3 53479064 missense probably benign 0.04
R0707:Proser1 UTSW 3 53478776 missense probably damaging 1.00
R1568:Proser1 UTSW 3 53477759 missense possibly damaging 0.54
R1997:Proser1 UTSW 3 53478871 missense probably benign 0.10
R2129:Proser1 UTSW 3 53477945 missense probably benign 0.20
R2207:Proser1 UTSW 3 53478391 missense probably benign 0.00
R2851:Proser1 UTSW 3 53480545 missense probably benign 0.07
R4077:Proser1 UTSW 3 53478541 missense probably damaging 1.00
R4093:Proser1 UTSW 3 53479712 critical splice donor site probably null
R4970:Proser1 UTSW 3 53464306 missense probably damaging 1.00
R4988:Proser1 UTSW 3 53479625 missense probably damaging 0.98
R5611:Proser1 UTSW 3 53478875 missense probably benign 0.10
R6146:Proser1 UTSW 3 53478119 missense probably damaging 1.00
R6459:Proser1 UTSW 3 53478329 missense possibly damaging 0.51
R6880:Proser1 UTSW 3 53477839 missense probably benign
R7308:Proser1 UTSW 3 53478704 missense probably benign 0.40
R7456:Proser1 UTSW 3 53478518 missense probably damaging 0.99
R7787:Proser1 UTSW 3 53473548 missense probably damaging 1.00
R7903:Proser1 UTSW 3 53479082 nonsense probably null
R8108:Proser1 UTSW 3 53472088 critical splice donor site probably null
R8172:Proser1 UTSW 3 53478851 missense possibly damaging 0.73
R8414:Proser1 UTSW 3 53478556 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGCTCACTTTTGCACG -3'
(R):5'- AGGGTGTACAGCTGCAGATG -3'

Sequencing Primer
(F):5'- TGCCCGTTATGATAAAAAGTGAGCC -3'
(R):5'- ACAGCTGCAGATGTGGTG -3'
Posted On2017-08-16