Incidental Mutation 'R6090:A2m'
ID486139
Institutional Source Beutler Lab
Gene Symbol A2m
Ensembl Gene ENSMUSG00000030111
Gene Namealpha-2-macroglobulin
SynonymsA2mp
MMRRC Submission 044247-MU
Accession Numbers

NCBI RefSeq: NM_175628.3; MGI:2449119

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6090 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location121635376-121679227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121648013 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 450 (A450V)
Ref Sequence ENSEMBL: ENSMUSP00000032203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032203]
Predicted Effect probably benign
Transcript: ENSMUST00000032203
AA Change: A450V

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: A450V

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:A2M_N 134 227 2.1e-20 PFAM
low complexity region 334 347 N/A INTRINSIC
A2M_N_2 465 613 2.04e-31 SMART
low complexity region 722 731 N/A INTRINSIC
A2M 738 828 2.31e-39 SMART
Pfam:Thiol-ester_cl 961 990 4.4e-18 PFAM
Pfam:A2M_comp 1010 1266 1.4e-98 PFAM
A2M_recep 1376 1463 2.69e-40 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,063,222 probably null Het
Adgrl3 A T 5: 81,512,326 N246I probably damaging Het
Arntl2 T A 6: 146,829,696 S500T possibly damaging Het
Cdipt A T 7: 126,976,959 M29L possibly damaging Het
Chml G T 1: 175,687,058 Y432* probably null Het
Clasp2 G T 9: 113,852,735 V320L probably benign Het
Col12a1 G A 9: 79,692,393 T826M probably damaging Het
Cpsf3 A G 12: 21,295,193 I169V probably damaging Het
Dhx36 G A 3: 62,496,820 T234M probably damaging Het
Dhx57 A G 17: 80,263,946 probably null Het
Dnah1 A T 14: 31,269,425 I3132N possibly damaging Het
Fbxw20 G T 9: 109,223,363 Q231K probably benign Het
Gfod1 G T 13: 43,200,961 Y179* probably null Het
Glg1 T A 8: 111,181,035 I510F probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gse1 C A 8: 120,571,169 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Klrd1 T C 6: 129,595,536 L97P probably damaging Het
Lgmn A T 12: 102,400,154 M240K probably damaging Het
Lrp1b A G 2: 41,185,868 probably null Het
Notch2 A T 3: 98,135,377 R1353* probably null Het
Olfr141 A C 2: 86,806,357 V214G possibly damaging Het
Olfr715b A G 7: 107,106,249 V204A possibly damaging Het
Pcdhb14 G A 18: 37,448,606 S255N probably benign Het
Pcgf2 C T 11: 97,690,991 M25I possibly damaging Het
Poll G T 19: 45,555,997 D328E probably benign Het
Pomgnt2 A T 9: 121,982,797 L306Q probably damaging Het
Proser1 A T 3: 53,478,667 M657L probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Rdh11 G T 12: 79,189,064 P37T probably benign Het
Rsph10b A T 5: 143,977,128 I286L probably benign Het
Sept4 G A 11: 87,589,517 R238K possibly damaging Het
Sptan1 C T 2: 29,993,887 R580C probably damaging Het
Stard9 T A 2: 120,693,654 W777R probably damaging Het
Timd2 T C 11: 46,687,236 T23A probably benign Het
Tmc4 A G 7: 3,671,053 Y376H probably damaging Het
Tmem143 A G 7: 45,909,526 I297M probably benign Het
Togaram1 A G 12: 64,967,801 T609A probably benign Het
Tyw3 T C 3: 154,597,067 H10R probably benign Het
Unc13b C A 4: 43,239,306 H3456Q probably damaging Het
Zfp131 A T 13: 119,775,996 H275Q probably damaging Het
Other mutations in A2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:A2m APN 6 121644149 missense possibly damaging 0.67
IGL00798:A2m APN 6 121671010 missense probably damaging 1.00
IGL01154:A2m APN 6 121673542 nonsense probably null
IGL01313:A2m APN 6 121645010 critical splice donor site probably null
IGL01337:A2m APN 6 121668570 missense probably damaging 0.98
IGL01505:A2m APN 6 121676947 missense possibly damaging 0.83
IGL01508:A2m APN 6 121659367 nonsense probably null
IGL01672:A2m APN 6 121641357 missense probably damaging 1.00
IGL01951:A2m APN 6 121667190 missense possibly damaging 0.78
IGL02012:A2m APN 6 121674861 missense probably damaging 1.00
IGL02066:A2m APN 6 121649895 missense probably damaging 1.00
IGL02234:A2m APN 6 121668220 missense possibly damaging 0.67
IGL02397:A2m APN 6 121646875 missense probably benign
IGL02407:A2m APN 6 121668616 nonsense probably null
IGL02408:A2m APN 6 121644171 missense probably damaging 0.99
IGL02469:A2m APN 6 121668115 missense probably damaging 1.00
IGL02527:A2m APN 6 121661433 missense probably damaging 0.99
IGL02612:A2m APN 6 121678012 missense probably benign
IGL02746:A2m APN 6 121669503 splice site probably benign
IGL02952:A2m APN 6 121678025 missense probably damaging 0.99
IGL03056:A2m APN 6 121670903 missense probably damaging 0.96
IGL03121:A2m APN 6 121641306 missense probably benign 0.02
IGL03303:A2m APN 6 121667163 missense probably damaging 1.00
IGL03369:A2m APN 6 121676903 critical splice acceptor site probably null
IGL03046:A2m UTSW 6 121659323 missense probably benign 0.04
R0040:A2m UTSW 6 121645206 missense possibly damaging 0.93
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0109:A2m UTSW 6 121659303 missense probably benign 0.00
R0147:A2m UTSW 6 121662446 critical splice donor site probably null
R0148:A2m UTSW 6 121662446 critical splice donor site probably null
R0345:A2m UTSW 6 121638272 splice site probably benign
R0445:A2m UTSW 6 121657955 missense probably damaging 1.00
R0766:A2m UTSW 6 121676890 splice site probably benign
R1186:A2m UTSW 6 121661534 missense probably benign 0.00
R1436:A2m UTSW 6 121644213 missense probably benign 0.09
R1452:A2m UTSW 6 121678056 missense probably benign 0.01
R1636:A2m UTSW 6 121654612 missense probably benign 0.04
R1637:A2m UTSW 6 121654612 missense probably benign 0.04
R1638:A2m UTSW 6 121654612 missense probably benign 0.04
R1698:A2m UTSW 6 121645158 missense possibly damaging 0.88
R1776:A2m UTSW 6 121641424 missense probably damaging 1.00
R1791:A2m UTSW 6 121654612 missense probably benign 0.04
R1918:A2m UTSW 6 121644936 missense probably benign 0.16
R1921:A2m UTSW 6 121654612 missense probably benign 0.04
R1927:A2m UTSW 6 121636379 missense probably damaging 1.00
R1934:A2m UTSW 6 121649833 missense probably damaging 0.98
R1943:A2m UTSW 6 121668547 missense possibly damaging 0.90
R1996:A2m UTSW 6 121669597 missense probably damaging 1.00
R2039:A2m UTSW 6 121659949 missense probably benign 0.32
R2085:A2m UTSW 6 121676959 missense probably damaging 1.00
R2092:A2m UTSW 6 121674937 nonsense probably null
R2105:A2m UTSW 6 121673500 missense probably benign 0.04
R2107:A2m UTSW 6 121654612 missense probably benign 0.04
R2235:A2m UTSW 6 121642064 missense probably benign 0.21
R2292:A2m UTSW 6 121673559 missense possibly damaging 0.90
R2350:A2m UTSW 6 121678088 splice site probably benign
R3001:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3002:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3023:A2m UTSW 6 121669572 missense probably benign 0.08
R3429:A2m UTSW 6 121636290 start codon destroyed probably null
R3437:A2m UTSW 6 121639294 missense probably null 0.03
R3909:A2m UTSW 6 121648166 missense probably damaging 1.00
R4300:A2m UTSW 6 121673475 missense probably benign 0.00
R4332:A2m UTSW 6 121657447 missense probably benign 0.01
R4584:A2m UTSW 6 121657406 missense probably benign 0.07
R4697:A2m UTSW 6 121638284 start codon destroyed probably null 0.94
R4710:A2m UTSW 6 121641303 missense probably benign 0.03
R4841:A2m UTSW 6 121646844 missense probably benign 0.06
R5206:A2m UTSW 6 121674807 missense probably damaging 1.00
R5219:A2m UTSW 6 121676950 missense possibly damaging 0.90
R5230:A2m UTSW 6 121674861 missense probably damaging 1.00
R5330:A2m UTSW 6 121638416 missense probably benign 0.11
R5331:A2m UTSW 6 121638416 missense probably benign 0.11
R5377:A2m UTSW 6 121645253 missense probably benign
R5590:A2m UTSW 6 121676932 missense probably damaging 1.00
R5835:A2m UTSW 6 121639336 missense probably damaging 1.00
R5910:A2m UTSW 6 121668117 missense probably damaging 1.00
R5915:A2m UTSW 6 121667163 missense probably damaging 1.00
R5949:A2m UTSW 6 121678073 missense probably damaging 1.00
R5994:A2m UTSW 6 121670903 missense probably benign 0.38
R5996:A2m UTSW 6 121659394 missense probably damaging 1.00
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6241:A2m UTSW 6 121646829 missense probably benign 0.09
R6294:A2m UTSW 6 121654481 missense probably benign
R6492:A2m UTSW 6 121654505 missense probably benign 0.35
R6554:A2m UTSW 6 121641287 missense probably damaging 1.00
R6597:A2m UTSW 6 121648121 missense probably damaging 1.00
R6742:A2m UTSW 6 121678036 missense probably benign 0.01
R6795:A2m UTSW 6 121648322 intron probably null
R6843:A2m UTSW 6 121638401 missense probably benign 0.01
R7013:A2m UTSW 6 121641386 missense probably null 0.00
R7137:A2m UTSW 6 121677985 missense possibly damaging 0.85
R7167:A2m UTSW 6 121647971 missense probably benign
R7294:A2m UTSW 6 121673582 nonsense probably null
R7452:A2m UTSW 6 121641332 missense probably damaging 1.00
R7507:A2m UTSW 6 121675218 missense probably benign 0.01
R7602:A2m UTSW 6 121642007 missense probably damaging 1.00
R7602:A2m UTSW 6 121670936 missense possibly damaging 0.79
R7709:A2m UTSW 6 121660104 missense possibly damaging 0.81
R7766:A2m UTSW 6 121638341 missense probably benign 0.08
X0057:A2m UTSW 6 121668176 missense probably damaging 1.00
X0060:A2m UTSW 6 121676080 missense probably damaging 1.00
X0063:A2m UTSW 6 121646876 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACTTGTAGCTGCTAGTGAAGGAG -3'
(R):5'- ACGTCAAAGTGGTGATGTGC -3'

Sequencing Primer
(F):5'- CTAGTGAAGGAGGAGGTATAAATCC -3'
(R):5'- ACCCCCAGAGAGCTTTATGTGTAG -3'
Posted On2017-08-16