Incidental Mutation 'R6090:Klrd1'
ID486140
Institutional Source Beutler Lab
Gene Symbol Klrd1
Ensembl Gene ENSMUSG00000030165
Gene Namekiller cell lectin-like receptor, subfamily D, member 1
SynonymsCD94
MMRRC Submission 044247-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6090 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location129591782-129598775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129595536 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 97 (L97P)
Ref Sequence ENSEMBL: ENSMUSP00000113399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032268] [ENSMUST00000112063] [ENSMUST00000119520] [ENSMUST00000159804]
Predicted Effect probably damaging
Transcript: ENSMUST00000032268
AA Change: L74P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032268
Gene: ENSMUSG00000030165
AA Change: L74P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CLECT 38 151 8.6e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112063
AA Change: L97P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107694
Gene: ENSMUSG00000030165
AA Change: L97P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
CLECT 61 175 2.84e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119520
AA Change: L97P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113399
Gene: ENSMUSG00000030165
AA Change: L97P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
CLECT 61 194 1.41e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159077
Predicted Effect probably benign
Transcript: ENSMUST00000159804
SMART Domains Protein: ENSMUSP00000123703
Gene: ENSMUSG00000030165

DomainStartEndE-ValueType
Blast:CLECT 5 54 5e-7 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000203965
AA Change: F33L
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Natural killer (NK) cells are a distinct lineage of lymphocytes that mediate cytotoxic activity and secrete cytokines upon immune stimulation. Several genes of the C-type lectin superfamily, including members of the NKG2 family, are expressed by NK cells and may be involved in the regulation of NK cell function. KLRD1 (CD94) is an antigen preferentially expressed on NK cells and is classified as a type II membrane protein because it has an external C terminus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal NK cell function and susceptibillity to infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,648,013 A450V probably benign Het
Abca8a T C 11: 110,063,222 probably null Het
Adgrl3 A T 5: 81,512,326 N246I probably damaging Het
Arntl2 T A 6: 146,829,696 S500T possibly damaging Het
Cdipt A T 7: 126,976,959 M29L possibly damaging Het
Chml G T 1: 175,687,058 Y432* probably null Het
Clasp2 G T 9: 113,852,735 V320L probably benign Het
Col12a1 G A 9: 79,692,393 T826M probably damaging Het
Cpsf3 A G 12: 21,295,193 I169V probably damaging Het
Dhx36 G A 3: 62,496,820 T234M probably damaging Het
Dhx57 A G 17: 80,263,946 probably null Het
Dnah1 A T 14: 31,269,425 I3132N possibly damaging Het
Fbxw20 G T 9: 109,223,363 Q231K probably benign Het
Gfod1 G T 13: 43,200,961 Y179* probably null Het
Glg1 T A 8: 111,181,035 I510F probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gse1 C A 8: 120,571,169 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lgmn A T 12: 102,400,154 M240K probably damaging Het
Lrp1b A G 2: 41,185,868 probably null Het
Notch2 A T 3: 98,135,377 R1353* probably null Het
Olfr141 A C 2: 86,806,357 V214G possibly damaging Het
Olfr715b A G 7: 107,106,249 V204A possibly damaging Het
Pcdhb14 G A 18: 37,448,606 S255N probably benign Het
Pcgf2 C T 11: 97,690,991 M25I possibly damaging Het
Poll G T 19: 45,555,997 D328E probably benign Het
Pomgnt2 A T 9: 121,982,797 L306Q probably damaging Het
Proser1 A T 3: 53,478,667 M657L probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Rdh11 G T 12: 79,189,064 P37T probably benign Het
Rsph10b A T 5: 143,977,128 I286L probably benign Het
Sept4 G A 11: 87,589,517 R238K possibly damaging Het
Sptan1 C T 2: 29,993,887 R580C probably damaging Het
Stard9 T A 2: 120,693,654 W777R probably damaging Het
Timd2 T C 11: 46,687,236 T23A probably benign Het
Tmc4 A G 7: 3,671,053 Y376H probably damaging Het
Tmem143 A G 7: 45,909,526 I297M probably benign Het
Togaram1 A G 12: 64,967,801 T609A probably benign Het
Tyw3 T C 3: 154,597,067 H10R probably benign Het
Unc13b C A 4: 43,239,306 H3456Q probably damaging Het
Zfp131 A T 13: 119,775,996 H275Q probably damaging Het
Other mutations in Klrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4305001:Klrd1 UTSW 6 129596707 missense unknown
R0056:Klrd1 UTSW 6 129593775 missense probably benign 0.06
R2284:Klrd1 UTSW 6 129598381 missense probably benign 0.09
R2357:Klrd1 UTSW 6 129596909 makesense probably null
R5381:Klrd1 UTSW 6 129595434 missense possibly damaging 0.46
R5421:Klrd1 UTSW 6 129598443 missense probably damaging 1.00
R6897:Klrd1 UTSW 6 129593505 missense possibly damaging 0.94
R7563:Klrd1 UTSW 6 129593738 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTTTGAATGCCAAGGAGTGC -3'
(R):5'- GAGGTTTGCACATTAACTCCTAATC -3'

Sequencing Primer
(F):5'- TTTGAATGCCAAGGAGTGCCAAAG -3'
(R):5'- TGTGCTTTCTAGTGTATATTTCAAGG -3'
Posted On2017-08-16