Incidental Mutation 'R6090:Tmem143'
ID486143
Institutional Source Beutler Lab
Gene Symbol Tmem143
Ensembl Gene ENSMUSG00000002781
Gene Nametransmembrane protein 143
Synonyms
MMRRC Submission 044247-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6090 (G1)
Quality Score171.009
Status Not validated
Chromosome7
Chromosomal Location45896941-45917413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45909526 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 297 (I297M)
Ref Sequence ENSEMBL: ENSMUSP00000070405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069772] [ENSMUST00000209350] [ENSMUST00000210503]
Predicted Effect probably benign
Transcript: ENSMUST00000069772
AA Change: I297M

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070405
Gene: ENSMUSG00000002781
AA Change: I297M

DomainStartEndE-ValueType
Pfam:DUF3754 182 349 3.6e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000209292
AA Change: T253A
Predicted Effect probably benign
Transcript: ENSMUST00000209350
AA Change: I292M

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209580
Predicted Effect probably benign
Transcript: ENSMUST00000210503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210692
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,648,013 A450V probably benign Het
Abca8a T C 11: 110,063,222 probably null Het
Adgrl3 A T 5: 81,512,326 N246I probably damaging Het
Arntl2 T A 6: 146,829,696 S500T possibly damaging Het
Cdipt A T 7: 126,976,959 M29L possibly damaging Het
Chml G T 1: 175,687,058 Y432* probably null Het
Clasp2 G T 9: 113,852,735 V320L probably benign Het
Col12a1 G A 9: 79,692,393 T826M probably damaging Het
Cpsf3 A G 12: 21,295,193 I169V probably damaging Het
Dhx36 G A 3: 62,496,820 T234M probably damaging Het
Dhx57 A G 17: 80,263,946 probably null Het
Dnah1 A T 14: 31,269,425 I3132N possibly damaging Het
Fbxw20 G T 9: 109,223,363 Q231K probably benign Het
Gfod1 G T 13: 43,200,961 Y179* probably null Het
Glg1 T A 8: 111,181,035 I510F probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gse1 C A 8: 120,571,169 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Klrd1 T C 6: 129,595,536 L97P probably damaging Het
Lgmn A T 12: 102,400,154 M240K probably damaging Het
Lrp1b A G 2: 41,185,868 probably null Het
Notch2 A T 3: 98,135,377 R1353* probably null Het
Olfr141 A C 2: 86,806,357 V214G possibly damaging Het
Olfr715b A G 7: 107,106,249 V204A possibly damaging Het
Pcdhb14 G A 18: 37,448,606 S255N probably benign Het
Pcgf2 C T 11: 97,690,991 M25I possibly damaging Het
Poll G T 19: 45,555,997 D328E probably benign Het
Pomgnt2 A T 9: 121,982,797 L306Q probably damaging Het
Proser1 A T 3: 53,478,667 M657L probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Rdh11 G T 12: 79,189,064 P37T probably benign Het
Rsph10b A T 5: 143,977,128 I286L probably benign Het
Sept4 G A 11: 87,589,517 R238K possibly damaging Het
Sptan1 C T 2: 29,993,887 R580C probably damaging Het
Stard9 T A 2: 120,693,654 W777R probably damaging Het
Timd2 T C 11: 46,687,236 T23A probably benign Het
Tmc4 A G 7: 3,671,053 Y376H probably damaging Het
Togaram1 A G 12: 64,967,801 T609A probably benign Het
Tyw3 T C 3: 154,597,067 H10R probably benign Het
Unc13b C A 4: 43,239,306 H3456Q probably damaging Het
Zfp131 A T 13: 119,775,996 H275Q probably damaging Het
Other mutations in Tmem143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Tmem143 APN 7 45916134 missense probably damaging 1.00
R0137:Tmem143 UTSW 7 45897662 missense probably benign 0.04
R0587:Tmem143 UTSW 7 45907054 missense probably damaging 1.00
R1450:Tmem143 UTSW 7 45907108 missense probably damaging 1.00
R1730:Tmem143 UTSW 7 45907002 missense possibly damaging 0.87
R1783:Tmem143 UTSW 7 45907002 missense possibly damaging 0.87
R1807:Tmem143 UTSW 7 45897613 missense probably damaging 0.99
R1874:Tmem143 UTSW 7 45916564 missense possibly damaging 0.68
R4460:Tmem143 UTSW 7 45906952 missense probably damaging 0.99
R7130:Tmem143 UTSW 7 45909477 missense possibly damaging 0.81
R7267:Tmem143 UTSW 7 45908174 missense probably benign 0.05
R8292:Tmem143 UTSW 7 45909540 missense probably damaging 0.96
R8303:Tmem143 UTSW 7 45916570 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATACTTCAAGCGTGTGGTG -3'
(R):5'- TACGAGGTCAGTCAAGCTGC -3'

Sequencing Primer
(F):5'- TGGCTGCCCGGACGAAAG -3'
(R):5'- CACTACGTTCTGAAAGATGCCAGTG -3'
Posted On2017-08-16