Incidental Mutation 'R6090:Olfr715b'
ID486144
Institutional Source Beutler Lab
Gene Symbol Olfr715b
Ensembl Gene ENSMUSG00000062987
Gene Nameolfactory receptor 715B
SynonymsEG384732, Gm10081
MMRRC Submission 044247-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6090 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location107103748-107110369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107106249 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 204 (V204A)
Ref Sequence ENSEMBL: ENSMUSP00000149136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081044] [ENSMUST00000215713]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081044
AA Change: V204A

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079834
Gene: ENSMUSG00000062987
AA Change: V204A

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 7e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 282 1.8e-7 PFAM
Pfam:7tm_1 41 288 2.5e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215713
AA Change: V204A

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,648,013 A450V probably benign Het
Abca8a T C 11: 110,063,222 probably null Het
Adgrl3 A T 5: 81,512,326 N246I probably damaging Het
Arntl2 T A 6: 146,829,696 S500T possibly damaging Het
Cdipt A T 7: 126,976,959 M29L possibly damaging Het
Chml G T 1: 175,687,058 Y432* probably null Het
Clasp2 G T 9: 113,852,735 V320L probably benign Het
Col12a1 G A 9: 79,692,393 T826M probably damaging Het
Cpsf3 A G 12: 21,295,193 I169V probably damaging Het
Dhx36 G A 3: 62,496,820 T234M probably damaging Het
Dhx57 A G 17: 80,263,946 probably null Het
Dnah1 A T 14: 31,269,425 I3132N possibly damaging Het
Fbxw20 G T 9: 109,223,363 Q231K probably benign Het
Gfod1 G T 13: 43,200,961 Y179* probably null Het
Glg1 T A 8: 111,181,035 I510F probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gse1 C A 8: 120,571,169 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Klrd1 T C 6: 129,595,536 L97P probably damaging Het
Lgmn A T 12: 102,400,154 M240K probably damaging Het
Lrp1b A G 2: 41,185,868 probably null Het
Notch2 A T 3: 98,135,377 R1353* probably null Het
Olfr141 A C 2: 86,806,357 V214G possibly damaging Het
Pcdhb14 G A 18: 37,448,606 S255N probably benign Het
Pcgf2 C T 11: 97,690,991 M25I possibly damaging Het
Poll G T 19: 45,555,997 D328E probably benign Het
Pomgnt2 A T 9: 121,982,797 L306Q probably damaging Het
Proser1 A T 3: 53,478,667 M657L probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Rdh11 G T 12: 79,189,064 P37T probably benign Het
Rsph10b A T 5: 143,977,128 I286L probably benign Het
Sept4 G A 11: 87,589,517 R238K possibly damaging Het
Sptan1 C T 2: 29,993,887 R580C probably damaging Het
Stard9 T A 2: 120,693,654 W777R probably damaging Het
Timd2 T C 11: 46,687,236 T23A probably benign Het
Tmc4 A G 7: 3,671,053 Y376H probably damaging Het
Tmem143 A G 7: 45,909,526 I297M probably benign Het
Togaram1 A G 12: 64,967,801 T609A probably benign Het
Tyw3 T C 3: 154,597,067 H10R probably benign Het
Unc13b C A 4: 43,239,306 H3456Q probably damaging Het
Zfp131 A T 13: 119,775,996 H275Q probably damaging Het
Other mutations in Olfr715b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Olfr715b APN 7 107106061 nonsense probably null
IGL00981:Olfr715b APN 7 107106062 missense probably benign 0.00
IGL01642:Olfr715b APN 7 107106822 missense possibly damaging 0.55
IGL03174:Olfr715b APN 7 107106270 missense probably benign 0.05
R1724:Olfr715b UTSW 7 107106202 missense probably benign 0.00
R2029:Olfr715b UTSW 7 107106436 missense probably benign
R2860:Olfr715b UTSW 7 107106468 missense probably benign 0.10
R2861:Olfr715b UTSW 7 107106468 missense probably benign 0.10
R2862:Olfr715b UTSW 7 107106468 missense probably benign 0.10
R3807:Olfr715b UTSW 7 107106463 missense probably benign 0.01
R4797:Olfr715b UTSW 7 107106027 missense probably benign 0.26
R5008:Olfr715b UTSW 7 107106081 missense probably damaging 0.99
R5918:Olfr715b UTSW 7 107106621 missense probably damaging 1.00
R6174:Olfr715b UTSW 7 107106507 missense probably damaging 1.00
R6253:Olfr715b UTSW 7 107105938 missense probably benign 0.00
R7408:Olfr715b UTSW 7 107106067 missense probably benign 0.05
R7483:Olfr715b UTSW 7 107106775 missense probably benign 0.00
R7750:Olfr715b UTSW 7 107106533 nonsense probably null
R8374:Olfr715b UTSW 7 107106826 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGACACCAGTTTCTCCTG -3'
(R):5'- TGTGTATCCAGCTGGCTACAG -3'

Sequencing Primer
(F):5'- AGTTTCTCCTGTTCTTTGGAAGAC -3'
(R):5'- ATCCAGCTGGCTACAGTGTCATG -3'
Posted On2017-08-16