Incidental Mutation 'R6090:Cdipt'
ID486145
Institutional Source Beutler Lab
Gene Symbol Cdipt
Ensembl Gene ENSMUSG00000030682
Gene NameCDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)
SynonymsD7Bwg0575e, 9530042F15Rik
MMRRC Submission 044247-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6090 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location126975914-126980501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126976959 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 29 (M29L)
Ref Sequence ENSEMBL: ENSMUSP00000145918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032920] [ENSMUST00000205437] [ENSMUST00000205830] [ENSMUST00000205903] [ENSMUST00000206170] [ENSMUST00000206296] [ENSMUST00000206346] [ENSMUST00000206450] [ENSMUST00000206780] [ENSMUST00000206794] [ENSMUST00000206816]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032920
AA Change: M29L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032920
Gene: ENSMUSG00000030682
AA Change: M29L

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 9 72 2.4e-16 PFAM
transmembrane domain 141 160 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181859
Predicted Effect probably benign
Transcript: ENSMUST00000205437
Predicted Effect possibly damaging
Transcript: ENSMUST00000205830
AA Change: M1L

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000205903
Predicted Effect possibly damaging
Transcript: ENSMUST00000206170
AA Change: M29L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000206296
Predicted Effect possibly damaging
Transcript: ENSMUST00000206346
AA Change: M29L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206450
AA Change: M29L

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206667
Predicted Effect probably benign
Transcript: ENSMUST00000206780
Predicted Effect possibly damaging
Transcript: ENSMUST00000206794
AA Change: M29L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000206816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206964
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol breakdown products are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. Two enzymes, CDP-diacylglycerol synthase and phosphatidylinositol synthase, are involved in the biosynthesis of phosphatidylinositol. Phosphatidylinositol synthase, a member of the CDP-alcohol phosphatidyl transferase class-I family, is an integral membrane protein found on the cytoplasmic side of the endoplasmic reticulum and the Golgi apparatus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,648,013 A450V probably benign Het
Abca8a T C 11: 110,063,222 probably null Het
Adgrl3 A T 5: 81,512,326 N246I probably damaging Het
Arntl2 T A 6: 146,829,696 S500T possibly damaging Het
Chml G T 1: 175,687,058 Y432* probably null Het
Clasp2 G T 9: 113,852,735 V320L probably benign Het
Col12a1 G A 9: 79,692,393 T826M probably damaging Het
Cpsf3 A G 12: 21,295,193 I169V probably damaging Het
Dhx36 G A 3: 62,496,820 T234M probably damaging Het
Dhx57 A G 17: 80,263,946 probably null Het
Dnah1 A T 14: 31,269,425 I3132N possibly damaging Het
Fbxw20 G T 9: 109,223,363 Q231K probably benign Het
Gfod1 G T 13: 43,200,961 Y179* probably null Het
Glg1 T A 8: 111,181,035 I510F probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gse1 C A 8: 120,571,169 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Klrd1 T C 6: 129,595,536 L97P probably damaging Het
Lgmn A T 12: 102,400,154 M240K probably damaging Het
Lrp1b A G 2: 41,185,868 probably null Het
Notch2 A T 3: 98,135,377 R1353* probably null Het
Olfr141 A C 2: 86,806,357 V214G possibly damaging Het
Olfr715b A G 7: 107,106,249 V204A possibly damaging Het
Pcdhb14 G A 18: 37,448,606 S255N probably benign Het
Pcgf2 C T 11: 97,690,991 M25I possibly damaging Het
Poll G T 19: 45,555,997 D328E probably benign Het
Pomgnt2 A T 9: 121,982,797 L306Q probably damaging Het
Proser1 A T 3: 53,478,667 M657L probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Rdh11 G T 12: 79,189,064 P37T probably benign Het
Rsph10b A T 5: 143,977,128 I286L probably benign Het
Sept4 G A 11: 87,589,517 R238K possibly damaging Het
Sptan1 C T 2: 29,993,887 R580C probably damaging Het
Stard9 T A 2: 120,693,654 W777R probably damaging Het
Timd2 T C 11: 46,687,236 T23A probably benign Het
Tmc4 A G 7: 3,671,053 Y376H probably damaging Het
Tmem143 A G 7: 45,909,526 I297M probably benign Het
Togaram1 A G 12: 64,967,801 T609A probably benign Het
Tyw3 T C 3: 154,597,067 H10R probably benign Het
Unc13b C A 4: 43,239,306 H3456Q probably damaging Het
Zfp131 A T 13: 119,775,996 H275Q probably damaging Het
Other mutations in Cdipt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Cdipt APN 7 126979553 missense possibly damaging 0.84
R0063:Cdipt UTSW 7 126979600 missense probably benign
R0063:Cdipt UTSW 7 126979600 missense probably benign
R0446:Cdipt UTSW 7 126978264 missense probably damaging 1.00
R0578:Cdipt UTSW 7 126979530 splice site probably null
R0828:Cdipt UTSW 7 126976920 missense probably damaging 1.00
R2020:Cdipt UTSW 7 126976933 missense possibly damaging 0.69
R4669:Cdipt UTSW 7 126978406 missense possibly damaging 0.82
R4731:Cdipt UTSW 7 126978358 missense probably damaging 1.00
R4732:Cdipt UTSW 7 126978358 missense probably damaging 1.00
R4733:Cdipt UTSW 7 126978358 missense probably damaging 1.00
R5590:Cdipt UTSW 7 126979532 splice site probably null
R5870:Cdipt UTSW 7 126978922 missense probably benign 0.28
R6034:Cdipt UTSW 7 126978325 missense probably damaging 0.99
R6034:Cdipt UTSW 7 126978325 missense probably damaging 0.99
R6084:Cdipt UTSW 7 126979601 missense probably benign 0.10
R7571:Cdipt UTSW 7 126979622 missense probably benign 0.05
R8245:Cdipt UTSW 7 126979560 missense probably benign
Z1177:Cdipt UTSW 7 126976944 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCGTGCCTAACCTTATCGG -3'
(R):5'- AGGGTCTAGGTCTTCCACAC -3'

Sequencing Primer
(F):5'- ACCTTATCGGTGAGTGCTGCC -3'
(R):5'- TTATATCCTAGGCAGCTCTCAACGAG -3'
Posted On2017-08-16