Incidental Mutation 'R6090:Gse1'
ID486147
Institutional Source Beutler Lab
Gene Symbol Gse1
Ensembl Gene ENSMUSG00000031822
Gene Namegenetic suppressor element 1, coiled-coil protein
Synonyms
MMRRC Submission 044247-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R6090 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location120228456-120581390 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 120571169 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034279] [ENSMUST00000118136] [ENSMUST00000120493] [ENSMUST00000127664]
Predicted Effect unknown
Transcript: ENSMUST00000034279
AA Change: T707N
SMART Domains Protein: ENSMUSP00000034279
Gene: ENSMUSG00000031822
AA Change: T707N

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
Pfam:DUF3736 81 216 2.9e-21 PFAM
coiled coil region 329 414 N/A INTRINSIC
Pfam:DUF3736 742 883 9.7e-46 PFAM
low complexity region 959 973 N/A INTRINSIC
low complexity region 1103 1124 N/A INTRINSIC
coiled coil region 1133 1207 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000118136
AA Change: T697N
SMART Domains Protein: ENSMUSP00000112981
Gene: ENSMUSG00000031822
AA Change: T697N

DomainStartEndE-ValueType
low complexity region 51 63 N/A INTRINSIC
Pfam:DUF3736 70 203 2.2e-39 PFAM
low complexity region 204 211 N/A INTRINSIC
coiled coil region 319 404 N/A INTRINSIC
Pfam:DUF3736 731 874 7.5e-48 PFAM
low complexity region 949 963 N/A INTRINSIC
low complexity region 1093 1114 N/A INTRINSIC
coiled coil region 1123 1197 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000120493
AA Change: T694N
SMART Domains Protein: ENSMUSP00000113577
Gene: ENSMUSG00000031822
AA Change: T694N

DomainStartEndE-ValueType
low complexity region 48 60 N/A INTRINSIC
Pfam:DUF3736 67 200 2.2e-39 PFAM
low complexity region 201 208 N/A INTRINSIC
coiled coil region 316 401 N/A INTRINSIC
Pfam:DUF3736 728 871 7.5e-48 PFAM
low complexity region 946 960 N/A INTRINSIC
low complexity region 1090 1111 N/A INTRINSIC
coiled coil region 1120 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147327
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,648,013 A450V probably benign Het
Abca8a T C 11: 110,063,222 probably null Het
Adgrl3 A T 5: 81,512,326 N246I probably damaging Het
Arntl2 T A 6: 146,829,696 S500T possibly damaging Het
Cdipt A T 7: 126,976,959 M29L possibly damaging Het
Chml G T 1: 175,687,058 Y432* probably null Het
Clasp2 G T 9: 113,852,735 V320L probably benign Het
Col12a1 G A 9: 79,692,393 T826M probably damaging Het
Cpsf3 A G 12: 21,295,193 I169V probably damaging Het
Dhx36 G A 3: 62,496,820 T234M probably damaging Het
Dhx57 A G 17: 80,263,946 probably null Het
Dnah1 A T 14: 31,269,425 I3132N possibly damaging Het
Fbxw20 G T 9: 109,223,363 Q231K probably benign Het
Gfod1 G T 13: 43,200,961 Y179* probably null Het
Glg1 T A 8: 111,181,035 I510F probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Klrd1 T C 6: 129,595,536 L97P probably damaging Het
Lgmn A T 12: 102,400,154 M240K probably damaging Het
Lrp1b A G 2: 41,185,868 probably null Het
Notch2 A T 3: 98,135,377 R1353* probably null Het
Olfr141 A C 2: 86,806,357 V214G possibly damaging Het
Olfr715b A G 7: 107,106,249 V204A possibly damaging Het
Pcdhb14 G A 18: 37,448,606 S255N probably benign Het
Pcgf2 C T 11: 97,690,991 M25I possibly damaging Het
Poll G T 19: 45,555,997 D328E probably benign Het
Pomgnt2 A T 9: 121,982,797 L306Q probably damaging Het
Proser1 A T 3: 53,478,667 M657L probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Rdh11 G T 12: 79,189,064 P37T probably benign Het
Rsph10b A T 5: 143,977,128 I286L probably benign Het
Sept4 G A 11: 87,589,517 R238K possibly damaging Het
Sptan1 C T 2: 29,993,887 R580C probably damaging Het
Stard9 T A 2: 120,693,654 W777R probably damaging Het
Timd2 T C 11: 46,687,236 T23A probably benign Het
Tmc4 A G 7: 3,671,053 Y376H probably damaging Het
Tmem143 A G 7: 45,909,526 I297M probably benign Het
Togaram1 A G 12: 64,967,801 T609A probably benign Het
Tyw3 T C 3: 154,597,067 H10R probably benign Het
Unc13b C A 4: 43,239,306 H3456Q probably damaging Het
Zfp131 A T 13: 119,775,996 H275Q probably damaging Het
Other mutations in Gse1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Gse1 APN 8 120553587 start codon destroyed probably null 0.79
IGL02484:Gse1 APN 8 120575262 intron probably benign
IGL02931:Gse1 APN 8 120578069 intron probably benign
IGL03193:Gse1 APN 8 120571340 critical splice donor site probably null
R0027:Gse1 UTSW 8 120566546 intron probably benign
R0109:Gse1 UTSW 8 120567785 missense probably damaging 1.00
R0257:Gse1 UTSW 8 120572334 intron probably benign
R0967:Gse1 UTSW 8 120570855 intron probably benign
R1395:Gse1 UTSW 8 120574999 intron probably benign
R1480:Gse1 UTSW 8 120572394 intron probably benign
R1532:Gse1 UTSW 8 120568210 intron probably benign
R1649:Gse1 UTSW 8 120578515 intron probably benign
R1728:Gse1 UTSW 8 120568253 intron probably benign
R1742:Gse1 UTSW 8 120566950 missense probably damaging 1.00
R1784:Gse1 UTSW 8 120568253 intron probably benign
R2081:Gse1 UTSW 8 120566480 missense probably damaging 1.00
R2110:Gse1 UTSW 8 120566980 missense probably damaging 1.00
R2974:Gse1 UTSW 8 120570897 intron probably benign
R3615:Gse1 UTSW 8 120572742 intron probably benign
R3616:Gse1 UTSW 8 120572742 intron probably benign
R3857:Gse1 UTSW 8 120571133 intron probably benign
R4201:Gse1 UTSW 8 120567764 missense probably benign 0.39
R4494:Gse1 UTSW 8 120570814 intron probably benign
R4857:Gse1 UTSW 8 120572757 intron probably benign
R4911:Gse1 UTSW 8 120568466 intron probably benign
R5640:Gse1 UTSW 8 120562677 missense possibly damaging 0.65
R5782:Gse1 UTSW 8 120566521 missense probably damaging 1.00
R5980:Gse1 UTSW 8 120229637 intron probably benign
R6156:Gse1 UTSW 8 120489127 missense possibly damaging 0.95
R6191:Gse1 UTSW 8 120553803 critical splice donor site probably null
R6270:Gse1 UTSW 8 120569163 intron probably benign
R6502:Gse1 UTSW 8 120553689 splice site probably null
R6573:Gse1 UTSW 8 120567797 missense probably damaging 1.00
R6885:Gse1 UTSW 8 120229482 intron probably benign
R6901:Gse1 UTSW 8 120229822 intron probably benign
R6959:Gse1 UTSW 8 120570971 intron probably benign
R7023:Gse1 UTSW 8 120230648 intron probably benign
R7210:Gse1 UTSW 8 120230702 missense unknown
R7263:Gse1 UTSW 8 120574171 missense unknown
R7449:Gse1 UTSW 8 120229711 missense unknown
R7602:Gse1 UTSW 8 120569304 missense unknown
R7627:Gse1 UTSW 8 120572777 missense unknown
R7635:Gse1 UTSW 8 120572895 missense unknown
R7689:Gse1 UTSW 8 120568478 missense unknown
R8108:Gse1 UTSW 8 120229810 missense unknown
R8326:Gse1 UTSW 8 120578580 missense unknown
R8474:Gse1 UTSW 8 120568384 intron probably benign
R8544:Gse1 UTSW 8 120553652 missense probably damaging 1.00
X0026:Gse1 UTSW 8 120568163 nonsense probably null
Z1177:Gse1 UTSW 8 120229852 missense unknown
Predicted Primers PCR Primer
(F):5'- GCGAGTTTATTGCTCAGAGAAGG -3'
(R):5'- TTGCACTGTAAGTTAAAAGTGGGAG -3'

Sequencing Primer
(F):5'- TTTATTGCTCAGAGAAGGCAGAG -3'
(R):5'- CCCATTCCCAGGAAGGTTG -3'
Posted On2017-08-16