Incidental Mutation 'R6090:Timd2'
ID486152
Institutional Source Beutler Lab
Gene Symbol Timd2
Ensembl Gene ENSMUSG00000040413
Gene NameT cell immunoglobulin and mucin domain containing 2
SynonymsTIM-2, Tim2
MMRRC Submission 044247-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6090 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location46668960-46707061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46687236 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 23 (T23A)
Ref Sequence ENSEMBL: ENSMUSP00000131540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055102] [ENSMUST00000109225] [ENSMUST00000125008] [ENSMUST00000169584]
Predicted Effect probably benign
Transcript: ENSMUST00000055102
AA Change: T23A

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000060891
Gene: ENSMUSG00000040413
AA Change: T23A

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109225
AA Change: T23A

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104848
Gene: ENSMUSG00000040413
AA Change: T23A

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125008
AA Change: T23A

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123042
Gene: ENSMUSG00000040413
AA Change: T23A

DomainStartEndE-ValueType
PDB:2OR7|B 19 92 6e-50 PDB
Blast:IG 22 92 4e-47 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169584
AA Change: T23A

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131540
Gene: ENSMUSG00000040413
AA Change: T23A

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an exacerbated inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,648,013 A450V probably benign Het
Abca8a T C 11: 110,063,222 probably null Het
Adgrl3 A T 5: 81,512,326 N246I probably damaging Het
Arntl2 T A 6: 146,829,696 S500T possibly damaging Het
Cdipt A T 7: 126,976,959 M29L possibly damaging Het
Chml G T 1: 175,687,058 Y432* probably null Het
Clasp2 G T 9: 113,852,735 V320L probably benign Het
Col12a1 G A 9: 79,692,393 T826M probably damaging Het
Cpsf3 A G 12: 21,295,193 I169V probably damaging Het
Dhx36 G A 3: 62,496,820 T234M probably damaging Het
Dhx57 A G 17: 80,263,946 probably null Het
Dnah1 A T 14: 31,269,425 I3132N possibly damaging Het
Fbxw20 G T 9: 109,223,363 Q231K probably benign Het
Gfod1 G T 13: 43,200,961 Y179* probably null Het
Glg1 T A 8: 111,181,035 I510F probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gse1 C A 8: 120,571,169 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Klrd1 T C 6: 129,595,536 L97P probably damaging Het
Lgmn A T 12: 102,400,154 M240K probably damaging Het
Lrp1b A G 2: 41,185,868 probably null Het
Notch2 A T 3: 98,135,377 R1353* probably null Het
Olfr141 A C 2: 86,806,357 V214G possibly damaging Het
Olfr715b A G 7: 107,106,249 V204A possibly damaging Het
Pcdhb14 G A 18: 37,448,606 S255N probably benign Het
Pcgf2 C T 11: 97,690,991 M25I possibly damaging Het
Poll G T 19: 45,555,997 D328E probably benign Het
Pomgnt2 A T 9: 121,982,797 L306Q probably damaging Het
Proser1 A T 3: 53,478,667 M657L probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Rdh11 G T 12: 79,189,064 P37T probably benign Het
Rsph10b A T 5: 143,977,128 I286L probably benign Het
Sept4 G A 11: 87,589,517 R238K possibly damaging Het
Sptan1 C T 2: 29,993,887 R580C probably damaging Het
Stard9 T A 2: 120,693,654 W777R probably damaging Het
Tmc4 A G 7: 3,671,053 Y376H probably damaging Het
Tmem143 A G 7: 45,909,526 I297M probably benign Het
Togaram1 A G 12: 64,967,801 T609A probably benign Het
Tyw3 T C 3: 154,597,067 H10R probably benign Het
Unc13b C A 4: 43,239,306 H3456Q probably damaging Het
Zfp131 A T 13: 119,775,996 H275Q probably damaging Het
Other mutations in Timd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Timd2 APN 11 46676343 missense probably benign 0.15
IGL01289:Timd2 APN 11 46679672 missense probably benign 0.00
IGL02066:Timd2 APN 11 46678223 missense probably damaging 0.98
IGL02439:Timd2 APN 11 46678236 splice site probably benign
R2217:Timd2 UTSW 11 46687017 missense probably damaging 1.00
R2218:Timd2 UTSW 11 46687017 missense probably damaging 1.00
R2240:Timd2 UTSW 11 46678216 missense probably benign 0.01
R3621:Timd2 UTSW 11 46678213 missense probably benign 0.00
R3876:Timd2 UTSW 11 46671020 critical splice acceptor site probably null
R4173:Timd2 UTSW 11 46670960 missense probably benign 0.00
R4793:Timd2 UTSW 11 46687181 missense probably damaging 1.00
R4799:Timd2 UTSW 11 46677267 nonsense probably null
R4963:Timd2 UTSW 11 46682790 missense possibly damaging 0.66
R5314:Timd2 UTSW 11 46677260 missense probably benign 0.09
R5798:Timd2 UTSW 11 46677237 missense probably benign 0.06
R6074:Timd2 UTSW 11 46687172 missense possibly damaging 0.88
R6694:Timd2 UTSW 11 46670952 nonsense probably null
R7817:Timd2 UTSW 11 46670954 missense probably benign 0.00
R8379:Timd2 UTSW 11 46677200 splice site probably null
Z1177:Timd2 UTSW 11 46679679 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCTATGGTCAAGGACACATTTCC -3'
(R):5'- CACCAATGATCAGCAAGGGC -3'

Sequencing Primer
(F):5'- GAAATATTCCCCTTTAGCTGGTATCG -3'
(R):5'- CAAGGGCTGAAGCTGTCCAG -3'
Posted On2017-08-16