Incidental Mutation 'R6090:Pcgf2'
ID486154
Institutional Source Beutler Lab
Gene Symbol Pcgf2
Ensembl Gene ENSMUSG00000018537
Gene Namepolycomb group ring finger 2
Synonymsmel-18, Rnf110, Zfp144
MMRRC Submission 044247-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6090 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location97688823-97700497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97690991 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 25 (M25I)
Ref Sequence ENSEMBL: ENSMUSP00000099438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018681] [ENSMUST00000103148] [ENSMUST00000103149] [ENSMUST00000107583] [ENSMUST00000107584] [ENSMUST00000107585] [ENSMUST00000169807] [ENSMUST00000179765]
Predicted Effect probably benign
Transcript: ENSMUST00000018681
AA Change: M209I

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000018681
Gene: ENSMUSG00000018537
AA Change: M209I

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
low complexity region 263 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103148
AA Change: M209I

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099437
Gene: ENSMUSG00000018537
AA Change: M209I

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
low complexity region 263 318 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103149
AA Change: M25I

PolyPhen 2 Score 0.706 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099438
Gene: ENSMUSG00000018537
AA Change: M25I

DomainStartEndE-ValueType
low complexity region 79 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107583
SMART Domains Protein: ENSMUSP00000103209
Gene: ENSMUSG00000078695

DomainStartEndE-ValueType
ZnF_CDGSH 54 88 3.39e-9 SMART
ZnF_CDGSH 92 129 5.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107584
SMART Domains Protein: ENSMUSP00000103210
Gene: ENSMUSG00000078695

DomainStartEndE-ValueType
ZnF_CDGSH 32 66 3.39e-9 SMART
ZnF_CDGSH 70 107 5.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107585
SMART Domains Protein: ENSMUSP00000103211
Gene: ENSMUSG00000078695

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
ZnF_CDGSH 51 85 3.39e-9 SMART
ZnF_CDGSH 89 126 5.55e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145623
Predicted Effect probably benign
Transcript: ENSMUST00000169807
AA Change: M209I

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126967
Gene: ENSMUSG00000018537
AA Change: M209I

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
Pfam:RAWUL 146 228 1.9e-26 PFAM
low complexity region 263 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179765
AA Change: M209I

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137517
Gene: ENSMUSG00000018537
AA Change: M209I

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
low complexity region 263 318 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger motif and is similar to the polycomb group (PcG) gene products. PcG gene products form complexes via protein-protein interaction and maintain the transcription repression of genes involved in embryogenesis, cell cycles, and tumorigenesis. This protein was shown to act as a negative regulator of transcription and has tumor suppressor activity. The expression of this gene was detected in various tumor cells, but is limited in neural organs in normal tissues. Knockout studies in mice suggested that this protein may negatively regulate the expression of different cytokines, chemokines, and chemokine receptors, and thus plays an important role in lymphocyte differentiation and migration, as well as in immune responses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit multiple abnormalities of the axial skeleton (including homeotic transformations), grow markedly slower, and die either perinatally or between 3-6 weeks of age depending on genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,648,013 A450V probably benign Het
Abca8a T C 11: 110,063,222 probably null Het
Adgrl3 A T 5: 81,512,326 N246I probably damaging Het
Arntl2 T A 6: 146,829,696 S500T possibly damaging Het
Cdipt A T 7: 126,976,959 M29L possibly damaging Het
Chml G T 1: 175,687,058 Y432* probably null Het
Clasp2 G T 9: 113,852,735 V320L probably benign Het
Col12a1 G A 9: 79,692,393 T826M probably damaging Het
Cpsf3 A G 12: 21,295,193 I169V probably damaging Het
Dhx36 G A 3: 62,496,820 T234M probably damaging Het
Dhx57 A G 17: 80,263,946 probably null Het
Dnah1 A T 14: 31,269,425 I3132N possibly damaging Het
Fbxw20 G T 9: 109,223,363 Q231K probably benign Het
Gfod1 G T 13: 43,200,961 Y179* probably null Het
Glg1 T A 8: 111,181,035 I510F probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gse1 C A 8: 120,571,169 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Klrd1 T C 6: 129,595,536 L97P probably damaging Het
Lgmn A T 12: 102,400,154 M240K probably damaging Het
Lrp1b A G 2: 41,185,868 probably null Het
Notch2 A T 3: 98,135,377 R1353* probably null Het
Olfr141 A C 2: 86,806,357 V214G possibly damaging Het
Olfr715b A G 7: 107,106,249 V204A possibly damaging Het
Pcdhb14 G A 18: 37,448,606 S255N probably benign Het
Poll G T 19: 45,555,997 D328E probably benign Het
Pomgnt2 A T 9: 121,982,797 L306Q probably damaging Het
Proser1 A T 3: 53,478,667 M657L probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Rdh11 G T 12: 79,189,064 P37T probably benign Het
Rsph10b A T 5: 143,977,128 I286L probably benign Het
Sept4 G A 11: 87,589,517 R238K possibly damaging Het
Sptan1 C T 2: 29,993,887 R580C probably damaging Het
Stard9 T A 2: 120,693,654 W777R probably damaging Het
Timd2 T C 11: 46,687,236 T23A probably benign Het
Tmc4 A G 7: 3,671,053 Y376H probably damaging Het
Tmem143 A G 7: 45,909,526 I297M probably benign Het
Togaram1 A G 12: 64,967,801 T609A probably benign Het
Tyw3 T C 3: 154,597,067 H10R probably benign Het
Unc13b C A 4: 43,239,306 H3456Q probably damaging Het
Zfp131 A T 13: 119,775,996 H275Q probably damaging Het
Other mutations in Pcgf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Pcgf2 APN 11 97690240 missense probably benign 0.01
IGL01877:Pcgf2 APN 11 97692533 missense probably damaging 1.00
IGL02473:Pcgf2 APN 11 97691921 splice site probably benign
R0243:Pcgf2 UTSW 11 97692418 unclassified probably null
R0522:Pcgf2 UTSW 11 97692047 missense probably benign 0.31
R0712:Pcgf2 UTSW 11 97691004 missense probably damaging 1.00
R0781:Pcgf2 UTSW 11 97691850 splice site probably benign
R1110:Pcgf2 UTSW 11 97691850 splice site probably benign
R4295:Pcgf2 UTSW 11 97693456 nonsense probably null
R4959:Pcgf2 UTSW 11 97691689 missense possibly damaging 0.85
R5569:Pcgf2 UTSW 11 97692367 critical splice donor site probably null
R5622:Pcgf2 UTSW 11 97690252 missense probably damaging 1.00
R5779:Pcgf2 UTSW 11 97690291 missense probably damaging 1.00
R6001:Pcgf2 UTSW 11 97692780 missense possibly damaging 0.91
R6360:Pcgf2 UTSW 11 97692409 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AAATGGCCTAGAGCTCACCAG -3'
(R):5'- GGTCCTAGAAAGAGAAGCCTCC -3'

Sequencing Primer
(F):5'- TAGAGCTCACCAGGGCCAG -3'
(R):5'- TTCTGGAAGGGAAGTCACATCTAC -3'
Posted On2017-08-16