Incidental Mutation 'R6090:Cpsf3'
ID486156
Institutional Source Beutler Lab
Gene Symbol Cpsf3
Ensembl Gene ENSMUSG00000054309
Gene Namecleavage and polyadenylation specificity factor 3
Synonyms73 kDa
MMRRC Submission 044247-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R6090 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location21285391-21315056 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21295193 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 169 (I169V)
Ref Sequence ENSEMBL: ENSMUSP00000068148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067284] [ENSMUST00000221145] [ENSMUST00000221507] [ENSMUST00000222474] [ENSMUST00000222968]
Predicted Effect probably damaging
Transcript: ENSMUST00000067284
AA Change: I169V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068148
Gene: ENSMUSG00000054309
AA Change: I169V

DomainStartEndE-ValueType
Lactamase_B 24 234 8.27e-12 SMART
Beta-Casp 246 367 7.32e-45 SMART
Pfam:RMMBL 380 422 9.9e-17 PFAM
CPSF73-100_C 477 683 6.78e-81 SMART
Predicted Effect unknown
Transcript: ENSMUST00000221042
AA Change: I119V
Predicted Effect possibly damaging
Transcript: ENSMUST00000221145
AA Change: I163V

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000221507
Predicted Effect probably benign
Transcript: ENSMUST00000222474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222883
Predicted Effect possibly damaging
Transcript: ENSMUST00000222968
AA Change: I169V

PolyPhen 2 Score 0.530 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the metallo-beta-lactamase family. The encoded protein is a 73kDa subunit of the cleavage and polyadenylation specificity factor and functions as an endonuclease that recognizes the pre-mRNA 3'-cleavage site AAUAAA prior to polyadenylation. It also cleaves after the pre-mRNA sequence ACCCA during histone 3'-end pre-mRNA processing. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,648,013 A450V probably benign Het
Abca8a T C 11: 110,063,222 probably null Het
Adgrl3 A T 5: 81,512,326 N246I probably damaging Het
Arntl2 T A 6: 146,829,696 S500T possibly damaging Het
Cdipt A T 7: 126,976,959 M29L possibly damaging Het
Chml G T 1: 175,687,058 Y432* probably null Het
Clasp2 G T 9: 113,852,735 V320L probably benign Het
Col12a1 G A 9: 79,692,393 T826M probably damaging Het
Dhx36 G A 3: 62,496,820 T234M probably damaging Het
Dhx57 A G 17: 80,263,946 probably null Het
Dnah1 A T 14: 31,269,425 I3132N possibly damaging Het
Fbxw20 G T 9: 109,223,363 Q231K probably benign Het
Gfod1 G T 13: 43,200,961 Y179* probably null Het
Glg1 T A 8: 111,181,035 I510F probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gse1 C A 8: 120,571,169 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Klrd1 T C 6: 129,595,536 L97P probably damaging Het
Lgmn A T 12: 102,400,154 M240K probably damaging Het
Lrp1b A G 2: 41,185,868 probably null Het
Notch2 A T 3: 98,135,377 R1353* probably null Het
Olfr141 A C 2: 86,806,357 V214G possibly damaging Het
Olfr715b A G 7: 107,106,249 V204A possibly damaging Het
Pcdhb14 G A 18: 37,448,606 S255N probably benign Het
Pcgf2 C T 11: 97,690,991 M25I possibly damaging Het
Poll G T 19: 45,555,997 D328E probably benign Het
Pomgnt2 A T 9: 121,982,797 L306Q probably damaging Het
Proser1 A T 3: 53,478,667 M657L probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Rdh11 G T 12: 79,189,064 P37T probably benign Het
Rsph10b A T 5: 143,977,128 I286L probably benign Het
Sept4 G A 11: 87,589,517 R238K possibly damaging Het
Sptan1 C T 2: 29,993,887 R580C probably damaging Het
Stard9 T A 2: 120,693,654 W777R probably damaging Het
Timd2 T C 11: 46,687,236 T23A probably benign Het
Tmc4 A G 7: 3,671,053 Y376H probably damaging Het
Tmem143 A G 7: 45,909,526 I297M probably benign Het
Togaram1 A G 12: 64,967,801 T609A probably benign Het
Tyw3 T C 3: 154,597,067 H10R probably benign Het
Unc13b C A 4: 43,239,306 H3456Q probably damaging Het
Zfp131 A T 13: 119,775,996 H275Q probably damaging Het
Other mutations in Cpsf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02039:Cpsf3 APN 12 21301456 missense probably damaging 1.00
IGL02192:Cpsf3 APN 12 21310193 unclassified probably benign
IGL02192:Cpsf3 APN 12 21310196 critical splice acceptor site probably null
IGL02651:Cpsf3 APN 12 21293297 missense probably damaging 1.00
IGL02963:Cpsf3 APN 12 21302422 missense probably damaging 0.99
IGL03072:Cpsf3 APN 12 21295088 missense possibly damaging 0.83
IGL03307:Cpsf3 APN 12 21296714 missense possibly damaging 0.87
IGL03335:Cpsf3 APN 12 21306887 splice site probably null
R0419:Cpsf3 UTSW 12 21297799 missense probably damaging 1.00
R0441:Cpsf3 UTSW 12 21300084 missense probably damaging 1.00
R1669:Cpsf3 UTSW 12 21305331 missense probably damaging 1.00
R1797:Cpsf3 UTSW 12 21306850 missense probably benign 0.01
R1801:Cpsf3 UTSW 12 21313790 missense probably benign 0.01
R1860:Cpsf3 UTSW 12 21296732 missense probably damaging 1.00
R3782:Cpsf3 UTSW 12 21300066 missense possibly damaging 0.83
R3953:Cpsf3 UTSW 12 21313805 missense probably benign
R3954:Cpsf3 UTSW 12 21313805 missense probably benign
R3955:Cpsf3 UTSW 12 21313805 missense probably benign
R3957:Cpsf3 UTSW 12 21313805 missense probably benign
R4922:Cpsf3 UTSW 12 21301537 missense probably damaging 1.00
R5112:Cpsf3 UTSW 12 21291784 missense probably benign
R5363:Cpsf3 UTSW 12 21308985 missense probably benign 0.00
R5507:Cpsf3 UTSW 12 21297928 missense probably damaging 1.00
R6144:Cpsf3 UTSW 12 21306886 splice site probably null
R6238:Cpsf3 UTSW 12 21300162 missense probably damaging 1.00
R7229:Cpsf3 UTSW 12 21296737 critical splice donor site probably null
X0060:Cpsf3 UTSW 12 21302392 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATAGCCTGTGCACTGTGAC -3'
(R):5'- GAACTTGCTGTTATGATGGAGAAGG -3'

Sequencing Primer
(F):5'- AGCCTGTGCACTGTGACATTAAG -3'
(R):5'- GCTGTTATGATGGAGAAGGAATATCC -3'
Posted On2017-08-16