Incidental Mutation 'R6090:Lgmn'
ID486159
Institutional Source Beutler Lab
Gene Symbol Lgmn
Ensembl Gene ENSMUSG00000021190
Gene Namelegumain
SynonymsPrsc1, preprolegumain, AEP
MMRRC Submission 044247-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6090 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location102394084-102439813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102400154 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 240 (M240K)
Ref Sequence ENSEMBL: ENSMUSP00000105647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021607] [ENSMUST00000110020]
Predicted Effect probably damaging
Transcript: ENSMUST00000021607
AA Change: M240K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021607
Gene: ENSMUSG00000021190
AA Change: M240K

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Peptidase_C13 31 288 8e-120 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110020
AA Change: M240K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105647
Gene: ENSMUSG00000021190
AA Change: M240K

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Peptidase_C13 31 288 8e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146499
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cysteine peptidase family C13 that plays an important role in the endosome/lysosomal degradation system. The encoded inactive preproprotein undergoes autocatalytic removal of the C-terminal inhibitory propeptide to generate the active endopeptidase that cleaves protein substrates on the C-terminal side of asparagine residues. Mice lacking the encoded protein exhibit defects in the lysosomal processing of proteins resulting in their accumulation in the lysosomes, and develop symptoms resembling hemophagocytic lymphohistiocytosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a null allele exhibit slow postnatal weight gain, develop features of hemophagocytic syndrome, and accumulate giant lysosomes in renal tubule cells. Homozygotes for another null allele display impaired TLR9 signaling in dendritic cells, progressive kidney pathology, and proteinuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,648,013 A450V probably benign Het
Abca8a T C 11: 110,063,222 probably null Het
Adgrl3 A T 5: 81,512,326 N246I probably damaging Het
Arntl2 T A 6: 146,829,696 S500T possibly damaging Het
Cdipt A T 7: 126,976,959 M29L possibly damaging Het
Chml G T 1: 175,687,058 Y432* probably null Het
Clasp2 G T 9: 113,852,735 V320L probably benign Het
Col12a1 G A 9: 79,692,393 T826M probably damaging Het
Cpsf3 A G 12: 21,295,193 I169V probably damaging Het
Dhx36 G A 3: 62,496,820 T234M probably damaging Het
Dhx57 A G 17: 80,263,946 probably null Het
Dnah1 A T 14: 31,269,425 I3132N possibly damaging Het
Fbxw20 G T 9: 109,223,363 Q231K probably benign Het
Gfod1 G T 13: 43,200,961 Y179* probably null Het
Glg1 T A 8: 111,181,035 I510F probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gse1 C A 8: 120,571,169 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Klrd1 T C 6: 129,595,536 L97P probably damaging Het
Lrp1b A G 2: 41,185,868 probably null Het
Notch2 A T 3: 98,135,377 R1353* probably null Het
Olfr141 A C 2: 86,806,357 V214G possibly damaging Het
Olfr715b A G 7: 107,106,249 V204A possibly damaging Het
Pcdhb14 G A 18: 37,448,606 S255N probably benign Het
Pcgf2 C T 11: 97,690,991 M25I possibly damaging Het
Poll G T 19: 45,555,997 D328E probably benign Het
Pomgnt2 A T 9: 121,982,797 L306Q probably damaging Het
Proser1 A T 3: 53,478,667 M657L probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Rdh11 G T 12: 79,189,064 P37T probably benign Het
Rsph10b A T 5: 143,977,128 I286L probably benign Het
Sept4 G A 11: 87,589,517 R238K possibly damaging Het
Sptan1 C T 2: 29,993,887 R580C probably damaging Het
Stard9 T A 2: 120,693,654 W777R probably damaging Het
Timd2 T C 11: 46,687,236 T23A probably benign Het
Tmc4 A G 7: 3,671,053 Y376H probably damaging Het
Tmem143 A G 7: 45,909,526 I297M probably benign Het
Togaram1 A G 12: 64,967,801 T609A probably benign Het
Tyw3 T C 3: 154,597,067 H10R probably benign Het
Unc13b C A 4: 43,239,306 H3456Q probably damaging Het
Zfp131 A T 13: 119,775,996 H275Q probably damaging Het
Other mutations in Lgmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Lgmn APN 12 102398176 splice site probably benign
IGL02069:Lgmn APN 12 102404299 missense possibly damaging 0.92
IGL02150:Lgmn APN 12 102395727 missense possibly damaging 0.80
IGL02228:Lgmn APN 12 102395714 missense probably benign 0.04
IGL02637:Lgmn APN 12 102400226 missense probably damaging 0.98
Getz UTSW 12 102399989 missense probably damaging 0.99
R0233:Lgmn UTSW 12 102399989 missense probably damaging 0.99
R0233:Lgmn UTSW 12 102399989 missense probably damaging 0.99
R0988:Lgmn UTSW 12 102398277 missense probably damaging 0.99
R1451:Lgmn UTSW 12 102405892 splice site probably benign
R1568:Lgmn UTSW 12 102394609 missense possibly damaging 0.95
R1944:Lgmn UTSW 12 102401924 missense probably damaging 1.00
R1972:Lgmn UTSW 12 102395821 unclassified probably benign
R2133:Lgmn UTSW 12 102394908 missense probably damaging 1.00
R2298:Lgmn UTSW 12 102395678 missense probably damaging 0.99
R3846:Lgmn UTSW 12 102404329 missense possibly damaging 0.87
R4610:Lgmn UTSW 12 102400124 splice site probably benign
R4788:Lgmn UTSW 12 102402677 missense probably benign 0.11
R5050:Lgmn UTSW 12 102403421 splice site probably null
R5708:Lgmn UTSW 12 102404328 missense possibly damaging 0.87
R5969:Lgmn UTSW 12 102405827 missense probably damaging 1.00
R6420:Lgmn UTSW 12 102423719 nonsense probably null
R6496:Lgmn UTSW 12 102398239 missense probably benign 0.01
R6592:Lgmn UTSW 12 102404270 missense probably damaging 1.00
R6659:Lgmn UTSW 12 102402692 missense probably benign 0.03
R7063:Lgmn UTSW 12 102402678 missense probably damaging 1.00
R7336:Lgmn UTSW 12 102423739 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ATTGCATGACATGGCTGGTG -3'
(R):5'- GACCCCAGTTTCAAGAGTAGTCC -3'

Sequencing Primer
(F):5'- CCAGGTGGTACTGCTTGTGAAG -3'
(R):5'- TTTCAAGAGTAGTCCAAGGCC -3'
Posted On2017-08-16