Incidental Mutation 'R6090:Zfp131'
ID486161
Institutional Source Beutler Lab
Gene Symbol Zfp131
Ensembl Gene ENSMUSG00000094870
Gene Namezinc finger protein 131
Synonyms2610109I01Rik, Znf131
MMRRC Submission 044247-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R6090 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location119765187-119790889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119775996 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 275 (H275Q)
Ref Sequence ENSEMBL: ENSMUSP00000153517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177916] [ENSMUST00000178271] [ENSMUST00000223722] [ENSMUST00000223813] [ENSMUST00000224946]
Predicted Effect probably damaging
Transcript: ENSMUST00000177916
AA Change: H275Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136867
Gene: ENSMUSG00000094870
AA Change: H275Q

DomainStartEndE-ValueType
BTB 34 129 4.83e-23 SMART
low complexity region 205 216 N/A INTRINSIC
ZnF_C2H2 261 283 6.23e-2 SMART
ZnF_C2H2 288 311 2.02e-1 SMART
ZnF_C2H2 328 350 4.11e-2 SMART
ZnF_C2H2 356 376 1.09e2 SMART
ZnF_C2H2 392 414 8.47e-4 SMART
ZnF_C2H2 420 443 1.14e0 SMART
low complexity region 532 548 N/A INTRINSIC
low complexity region 581 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178271
SMART Domains Protein: ENSMUSP00000136019
Gene: ENSMUSG00000094870

DomainStartEndE-ValueType
BTB 34 129 4.83e-23 SMART
low complexity region 205 216 N/A INTRINSIC
ZnF_C2H2 254 277 2.02e-1 SMART
ZnF_C2H2 294 316 4.11e-2 SMART
ZnF_C2H2 322 342 1.09e2 SMART
ZnF_C2H2 358 380 8.47e-4 SMART
ZnF_C2H2 386 409 1.14e0 SMART
low complexity region 498 514 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223722
AA Change: H275Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000223797
Predicted Effect probably benign
Transcript: ENSMUST00000223813
Predicted Effect probably damaging
Transcript: ENSMUST00000224946
AA Change: H275Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224969
Predicted Effect probably benign
Transcript: ENSMUST00000225484
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the BTB/POZ family of transcription factors. This protein has been found to act as a transcriptional activator and may regulate estrogen receptor signaling. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,648,013 A450V probably benign Het
Abca8a T C 11: 110,063,222 probably null Het
Adgrl3 A T 5: 81,512,326 N246I probably damaging Het
Arntl2 T A 6: 146,829,696 S500T possibly damaging Het
Cdipt A T 7: 126,976,959 M29L possibly damaging Het
Chml G T 1: 175,687,058 Y432* probably null Het
Clasp2 G T 9: 113,852,735 V320L probably benign Het
Col12a1 G A 9: 79,692,393 T826M probably damaging Het
Cpsf3 A G 12: 21,295,193 I169V probably damaging Het
Dhx36 G A 3: 62,496,820 T234M probably damaging Het
Dhx57 A G 17: 80,263,946 probably null Het
Dnah1 A T 14: 31,269,425 I3132N possibly damaging Het
Fbxw20 G T 9: 109,223,363 Q231K probably benign Het
Gfod1 G T 13: 43,200,961 Y179* probably null Het
Glg1 T A 8: 111,181,035 I510F probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gse1 C A 8: 120,571,169 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Klrd1 T C 6: 129,595,536 L97P probably damaging Het
Lgmn A T 12: 102,400,154 M240K probably damaging Het
Lrp1b A G 2: 41,185,868 probably null Het
Notch2 A T 3: 98,135,377 R1353* probably null Het
Olfr141 A C 2: 86,806,357 V214G possibly damaging Het
Olfr715b A G 7: 107,106,249 V204A possibly damaging Het
Pcdhb14 G A 18: 37,448,606 S255N probably benign Het
Pcgf2 C T 11: 97,690,991 M25I possibly damaging Het
Poll G T 19: 45,555,997 D328E probably benign Het
Pomgnt2 A T 9: 121,982,797 L306Q probably damaging Het
Proser1 A T 3: 53,478,667 M657L probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Rdh11 G T 12: 79,189,064 P37T probably benign Het
Rsph10b A T 5: 143,977,128 I286L probably benign Het
Sept4 G A 11: 87,589,517 R238K possibly damaging Het
Sptan1 C T 2: 29,993,887 R580C probably damaging Het
Stard9 T A 2: 120,693,654 W777R probably damaging Het
Timd2 T C 11: 46,687,236 T23A probably benign Het
Tmc4 A G 7: 3,671,053 Y376H probably damaging Het
Tmem143 A G 7: 45,909,526 I297M probably benign Het
Togaram1 A G 12: 64,967,801 T609A probably benign Het
Tyw3 T C 3: 154,597,067 H10R probably benign Het
Unc13b C A 4: 43,239,306 H3456Q probably damaging Het
Other mutations in Zfp131
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1444:Zfp131 UTSW 13 119790248 missense probably damaging 0.99
R1604:Zfp131 UTSW 13 119768780 missense probably damaging 1.00
R1605:Zfp131 UTSW 13 119768780 missense probably damaging 1.00
R1712:Zfp131 UTSW 13 119766543 missense probably benign 0.00
R1899:Zfp131 UTSW 13 119767025 missense probably damaging 0.99
R2207:Zfp131 UTSW 13 119775812 missense probably damaging 1.00
R4227:Zfp131 UTSW 13 119766746 missense probably damaging 1.00
R4342:Zfp131 UTSW 13 119776018 missense probably damaging 0.99
R4852:Zfp131 UTSW 13 119788858 critical splice donor site probably null
R4876:Zfp131 UTSW 13 119788955 missense possibly damaging 0.88
R4990:Zfp131 UTSW 13 119782913 missense probably damaging 1.00
R5979:Zfp131 UTSW 13 119776446 missense probably benign 0.03
R6269:Zfp131 UTSW 13 119766405 missense possibly damaging 0.86
R6791:Zfp131 UTSW 13 119766593 missense probably damaging 0.98
R7147:Zfp131 UTSW 13 119766543 missense probably benign 0.00
R7217:Zfp131 UTSW 13 119775841 missense probably damaging 0.99
R7809:Zfp131 UTSW 13 119788910 missense probably damaging 1.00
R7815:Zfp131 UTSW 13 119775980 missense probably damaging 0.99
R8231:Zfp131 UTSW 13 119775812 missense probably damaging 0.99
R8308:Zfp131 UTSW 13 119782904 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GTTTGTCACAGTACTGGCATATG -3'
(R):5'- ACAGGCTCCTCCGATGATTC -3'

Sequencing Primer
(F):5'- ACGCACTCTCTCGAAGAT -3'
(R):5'- TGTTGGCAGATATCACCAGC -3'
Posted On2017-08-16