Incidental Mutation 'R6090:Poll'
ID486165
Institutional Source Beutler Lab
Gene Symbol Poll
Ensembl Gene ENSMUSG00000025218
Gene Namepolymerase (DNA directed), lambda
Synonyms
MMRRC Submission 044247-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6090 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location45552275-45560531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 45555997 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 328 (D328E)
Ref Sequence ENSEMBL: ENSMUSP00000026239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026239] [ENSMUST00000047057]
Predicted Effect probably benign
Transcript: ENSMUST00000026239
AA Change: D328E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026239
Gene: ENSMUSG00000025218
AA Change: D328E

DomainStartEndE-ValueType
PDB:2JW5|A 35 134 4e-35 PDB
Blast:BRCT 39 121 5e-32 BLAST
low complexity region 220 233 N/A INTRINSIC
POLXc 249 572 2.71e-79 SMART
HhH1 295 314 3.11e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047057
SMART Domains Protein: ENSMUSP00000045683
Gene: ENSMUSG00000041035

DomainStartEndE-ValueType
Pfam:DPCD 6 195 4.5e-92 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA polymerase. DNA polymerases catalyze DNA-template-directed extension of the 3'-end of a DNA strand. This particular polymerase, which is a member of the X family of DNA polymerases, likely plays a role in non-homologous end joining and other DNA repair processes. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective heavy chain rearrangement. See also the Dpcd gene for mutations that affect both of these overlapping genes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,648,013 A450V probably benign Het
Abca8a T C 11: 110,063,222 probably null Het
Adgrl3 A T 5: 81,512,326 N246I probably damaging Het
Arntl2 T A 6: 146,829,696 S500T possibly damaging Het
Cdipt A T 7: 126,976,959 M29L possibly damaging Het
Chml G T 1: 175,687,058 Y432* probably null Het
Clasp2 G T 9: 113,852,735 V320L probably benign Het
Col12a1 G A 9: 79,692,393 T826M probably damaging Het
Cpsf3 A G 12: 21,295,193 I169V probably damaging Het
Dhx36 G A 3: 62,496,820 T234M probably damaging Het
Dhx57 A G 17: 80,263,946 probably null Het
Dnah1 A T 14: 31,269,425 I3132N possibly damaging Het
Fbxw20 G T 9: 109,223,363 Q231K probably benign Het
Gfod1 G T 13: 43,200,961 Y179* probably null Het
Glg1 T A 8: 111,181,035 I510F probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gse1 C A 8: 120,571,169 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Klrd1 T C 6: 129,595,536 L97P probably damaging Het
Lgmn A T 12: 102,400,154 M240K probably damaging Het
Lrp1b A G 2: 41,185,868 probably null Het
Notch2 A T 3: 98,135,377 R1353* probably null Het
Olfr141 A C 2: 86,806,357 V214G possibly damaging Het
Olfr715b A G 7: 107,106,249 V204A possibly damaging Het
Pcdhb14 G A 18: 37,448,606 S255N probably benign Het
Pcgf2 C T 11: 97,690,991 M25I possibly damaging Het
Pomgnt2 A T 9: 121,982,797 L306Q probably damaging Het
Proser1 A T 3: 53,478,667 M657L probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Rdh11 G T 12: 79,189,064 P37T probably benign Het
Rsph10b A T 5: 143,977,128 I286L probably benign Het
Sept4 G A 11: 87,589,517 R238K possibly damaging Het
Sptan1 C T 2: 29,993,887 R580C probably damaging Het
Stard9 T A 2: 120,693,654 W777R probably damaging Het
Timd2 T C 11: 46,687,236 T23A probably benign Het
Tmc4 A G 7: 3,671,053 Y376H probably damaging Het
Tmem143 A G 7: 45,909,526 I297M probably benign Het
Togaram1 A G 12: 64,967,801 T609A probably benign Het
Tyw3 T C 3: 154,597,067 H10R probably benign Het
Unc13b C A 4: 43,239,306 H3456Q probably damaging Het
Zfp131 A T 13: 119,775,996 H275Q probably damaging Het
Other mutations in Poll
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Poll APN 19 45553601 missense probably damaging 0.99
IGL01369:Poll APN 19 45553676 missense probably damaging 1.00
R0308:Poll UTSW 19 45555965 missense probably damaging 1.00
R0374:Poll UTSW 19 45557870 missense probably benign 0.21
R2090:Poll UTSW 19 45558838 missense probably benign 0.24
R3721:Poll UTSW 19 45553577 missense probably damaging 0.99
R3938:Poll UTSW 19 45558418 unclassified probably benign
R4171:Poll UTSW 19 45556053 missense probably damaging 1.00
R4626:Poll UTSW 19 45555124 missense probably benign 0.02
R5990:Poll UTSW 19 45553155 missense possibly damaging 0.91
R6433:Poll UTSW 19 45553604 missense probably benign 0.00
R7023:Poll UTSW 19 45558838 missense probably benign
R7436:Poll UTSW 19 45553057 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGAGGGACCCAGATTCC -3'
(R):5'- AAGGACAAGCTCCATATGGTTG -3'

Sequencing Primer
(F):5'- CCAGATTCCTGCAGGTGAACAG -3'
(R):5'- CTCCATATGGTTGCTGGGCTAC -3'
Posted On2017-08-16