Incidental Mutation 'R6030:Pck1'
ID486177
Institutional Source Beutler Lab
Gene Symbol Pck1
Ensembl Gene ENSMUSG00000027513
Gene Namephosphoenolpyruvate carboxykinase 1, cytosolic
SynonymsPEPCK, Pck-1
MMRRC Submission 044202-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6030 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location173153048-173159273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173154857 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 188 (E188G)
Ref Sequence ENSEMBL: ENSMUSP00000029017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029017]
Predicted Effect probably benign
Transcript: ENSMUST00000029017
AA Change: E188G

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029017
Gene: ENSMUSG00000027513
AA Change: E188G

DomainStartEndE-ValueType
Pfam:PEPCK 29 619 3.2e-275 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151269
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a main control point for the regulation of gluconeogenesis. The cytosolic enzyme encoded by this gene, along with GTP, catalyzes the formation of phosphoenolpyruvate from oxaloacetate, with the release of carbon dioxide and GDP. The expression of this gene can be regulated by insulin, glucocorticoids, glucagon, cAMP, and diet. Defects in this gene are a cause of cytosolic phosphoenolpyruvate carboxykinase deficiency. A mitochondrial isozyme of the encoded protein also has been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit early postnatal lethality, decreased body fat, decreased glycogen levels in the liver, and altered blood chemistry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,255,733 W59R probably damaging Het
Abca16 A G 7: 120,533,798 N1317D probably benign Het
Abhd8 T A 8: 71,458,150 Y338F possibly damaging Het
Actg2 G T 6: 83,516,364 N297K probably damaging Het
Agap1 A G 1: 89,630,434 D148G probably damaging Het
Alox12 T C 11: 70,254,591 D52G possibly damaging Het
Ano5 T A 7: 51,574,825 S496T probably damaging Het
Arl6ip4 T C 5: 124,117,905 probably null Het
Atp4a G C 7: 30,722,516 E826Q probably damaging Het
Bbs7 T C 3: 36,602,911 D256G probably damaging Het
Bckdha T A 7: 25,631,441 D50V probably damaging Het
Cast A G 13: 74,695,937 S693P possibly damaging Het
Col6a1 T C 10: 76,709,866 Y924C unknown Het
Crkl A G 16: 17,452,740 Y88C probably damaging Het
Cse1l T C 2: 166,919,621 F32L probably benign Het
Dmxl2 C T 9: 54,393,673 V2385I probably benign Het
Dnah1 T A 14: 31,268,027 I3219F probably damaging Het
Dnah17 C T 11: 118,025,549 R4266H probably benign Het
Efcab5 A G 11: 77,121,262 L722P probably damaging Het
Emilin3 C A 2: 160,909,185 V215L probably benign Het
Esr1 A T 10: 4,746,622 N157I possibly damaging Het
Esrrg A G 1: 188,198,707 M309V probably benign Het
Fam120b G A 17: 15,401,910 R50Q probably damaging Het
Fat2 G T 11: 55,310,303 Y648* probably null Het
Gbp2b T A 3: 142,603,653 I175N probably benign Het
Gm1043 T A 5: 37,154,608 probably benign Het
Gm21060 A G 19: 61,296,973 C33R possibly damaging Het
Gm9803 C T 10: 43,524,256 A30V probably benign Het
Gpx6 C T 13: 21,312,340 S28L probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifi44 T C 3: 151,749,558 Q10R probably benign Het
Impa2 T C 18: 67,318,428 V264A probably benign Het
Khdc1a A T 1: 21,350,884 M98L probably benign Het
Lrrc45 T A 11: 120,720,648 L616* probably null Het
Mios A T 6: 8,215,704 H300L probably benign Het
Mllt6 A T 11: 97,677,225 T827S probably damaging Het
Mrc1 C A 2: 14,316,901 D1068E probably benign Het
Ndst3 T C 3: 123,552,519 Y702C probably damaging Het
Nek11 T A 9: 105,204,888 probably null Het
Nek4 T C 14: 30,956,933 F138S probably damaging Het
Nfatc4 T A 14: 55,832,440 Y688* probably null Het
Nlrx1 C T 9: 44,263,760 V240M probably damaging Het
Npy6r A T 18: 44,276,082 Y190F probably benign Het
Olfr338 T G 2: 36,377,544 L256R probably damaging Het
Olfr472 A G 7: 107,903,413 E232G probably benign Het
Olfr509 A C 7: 108,646,226 S117A possibly damaging Het
Olfr548-ps1 C A 7: 102,542,610 R225S probably benign Het
Olfr780 A T 10: 129,322,369 T249S probably benign Het
Olfr960 T C 9: 39,623,341 F71L probably damaging Het
Osbpl7 A C 11: 97,052,261 H113P probably benign Het
Pimreg A G 11: 72,045,750 D213G probably benign Het
Pkd1l2 A G 8: 117,043,237 I1160T probably damaging Het
Ppargc1b G A 18: 61,307,934 Q622* probably null Het
Ppfia2 T A 10: 106,906,477 C1044S probably damaging Het
Ppp4r3a A G 12: 101,058,400 V280A probably damaging Het
Ptprf T C 4: 118,211,048 N1764D probably benign Het
Pygm C T 19: 6,388,812 R311C possibly damaging Het
Rab7b A G 1: 131,698,561 K109R probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Sdccag3 T C 2: 26,386,971 D249G possibly damaging Het
Setbp1 T G 18: 78,857,711 I914L probably benign Het
Shprh A C 10: 11,151,991 Q114P probably benign Het
Slc5a9 T C 4: 111,885,528 I456V possibly damaging Het
Slc8b1 T C 5: 120,519,920 probably null Het
Spin1 T A 13: 51,139,516 Y87* probably null Het
Srebf2 T C 15: 82,177,276 probably null Het
Sufu T C 19: 46,475,539 Y397H probably damaging Het
Tgfb3 A C 12: 86,063,850 V242G probably benign Het
Tgm3 A T 2: 130,042,000 Y526F probably damaging Het
Tmem209 A G 6: 30,482,968 L508P probably damaging Het
Tmem67 T C 4: 12,063,799 D454G probably benign Het
Ttn T C 2: 76,816,599 E3280G possibly damaging Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Umps A G 16: 33,962,138 V138A probably benign Het
Wdr66 C T 5: 123,274,204 T532M probably damaging Het
Ypel1 A G 16: 17,084,513 probably null Het
Zdhhc19 T A 16: 32,499,042 L63Q probably null Het
Other mutations in Pck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Pck1 APN 2 173154118 critical splice donor site probably null
IGL00817:Pck1 APN 2 173153432 missense possibly damaging 0.47
IGL02476:Pck1 APN 2 173158282 missense probably benign
IGL02803:Pck1 APN 2 173156004 missense probably damaging 1.00
IGL02874:Pck1 APN 2 173155249 missense probably damaging 1.00
IGL02886:Pck1 APN 2 173154856 missense probably benign 0.43
R0041:Pck1 UTSW 2 173155210 missense probably benign 0.21
R0125:Pck1 UTSW 2 173156081 nonsense probably null
R0238:Pck1 UTSW 2 173157068 missense possibly damaging 0.91
R0238:Pck1 UTSW 2 173157068 missense possibly damaging 0.91
R0373:Pck1 UTSW 2 173153390 start codon destroyed probably null 0.99
R0595:Pck1 UTSW 2 173157029 missense probably damaging 1.00
R1338:Pck1 UTSW 2 173158410 missense probably benign 0.18
R1623:Pck1 UTSW 2 173154718 missense probably benign 0.26
R1752:Pck1 UTSW 2 173157113 missense probably benign 0.00
R2107:Pck1 UTSW 2 173154068 missense probably benign 0.00
R2376:Pck1 UTSW 2 173157116 missense probably benign
R2883:Pck1 UTSW 2 173158575 missense probably benign 0.03
R3508:Pck1 UTSW 2 173158384 missense possibly damaging 0.61
R4718:Pck1 UTSW 2 173155221 missense probably damaging 0.99
R4853:Pck1 UTSW 2 173154714 nonsense probably null
R4907:Pck1 UTSW 2 173157023 missense probably damaging 1.00
R4950:Pck1 UTSW 2 173154827 missense probably benign
R5073:Pck1 UTSW 2 173156977 missense probably benign 0.41
R5134:Pck1 UTSW 2 173153489 missense probably benign 0.23
R5213:Pck1 UTSW 2 173156085 nonsense probably null
R5244:Pck1 UTSW 2 173154863 missense possibly damaging 0.91
R5654:Pck1 UTSW 2 173158560 missense probably damaging 1.00
R5831:Pck1 UTSW 2 173156999 missense probably damaging 1.00
R6030:Pck1 UTSW 2 173154857 missense probably benign 0.40
R6143:Pck1 UTSW 2 173154012 missense probably damaging 0.99
R6276:Pck1 UTSW 2 173157319 missense probably damaging 1.00
R7553:Pck1 UTSW 2 173157067 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TACCATTAGGAGGAGGAGCC -3'
(R):5'- AAGCCACAGTGAGCTTGTGG -3'

Sequencing Primer
(F):5'- AGCCGAGGATGCTCAGTG -3'
(R):5'- AGCTTGTGGTGCACATCC -3'
Posted On2017-08-16