Incidental Mutation 'R6030:Tmem209'
ID486191
Institutional Source Beutler Lab
Gene Symbol Tmem209
Ensembl Gene ENSMUSG00000029782
Gene Nametransmembrane protein 209
Synonyms2700094F01Rik
MMRRC Submission 044202-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.745) question?
Stock #R6030 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location30479053-30509783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30482968 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 508 (L508P)
Ref Sequence ENSEMBL: ENSMUSP00000100056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064330] [ENSMUST00000102991] [ENSMUST00000115157] [ENSMUST00000115160] [ENSMUST00000138823] [ENSMUST00000151187] [ENSMUST00000222934]
Predicted Effect probably benign
Transcript: ENSMUST00000064330
SMART Domains Protein: ENSMUSP00000067667
Gene: ENSMUSG00000029782

DomainStartEndE-ValueType
Pfam:CytochromB561_N 5 343 4.1e-88 PFAM
Pfam:CytochromB561_N 341 438 2.2e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102991
AA Change: L508P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100056
Gene: ENSMUSG00000029782
AA Change: L508P

DomainStartEndE-ValueType
Pfam:CytochromB561_N 5 376 5.2e-107 PFAM
Pfam:CytochromB561_N 372 519 3.1e-79 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115157
AA Change: L549P

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110810
Gene: ENSMUSG00000029782
AA Change: L549P

DomainStartEndE-ValueType
Pfam:CytochromB561_N 4 560 4.8e-209 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115160
AA Change: L550P

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110813
Gene: ENSMUSG00000029782
AA Change: L550P

DomainStartEndE-ValueType
Pfam:CytochromB561_N 6 560 6.4e-159 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000138823
AA Change: L550P

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138292
Gene: ENSMUSG00000029782
AA Change: L550P

DomainStartEndE-ValueType
Pfam:CytochromB561_N 5 560 1.2e-205 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000151187
AA Change: L392P

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138232
Gene: ENSMUSG00000029782
AA Change: L392P

DomainStartEndE-ValueType
Pfam:CytochromB561_N 1 403 1.5e-160 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000222934
AA Change: L392P

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,255,733 W59R probably damaging Het
Abca16 A G 7: 120,533,798 N1317D probably benign Het
Abhd8 T A 8: 71,458,150 Y338F possibly damaging Het
Actg2 G T 6: 83,516,364 N297K probably damaging Het
Agap1 A G 1: 89,630,434 D148G probably damaging Het
Alox12 T C 11: 70,254,591 D52G possibly damaging Het
Ano5 T A 7: 51,574,825 S496T probably damaging Het
Arl6ip4 T C 5: 124,117,905 probably null Het
Atp4a G C 7: 30,722,516 E826Q probably damaging Het
Bbs7 T C 3: 36,602,911 D256G probably damaging Het
Bckdha T A 7: 25,631,441 D50V probably damaging Het
Cast A G 13: 74,695,937 S693P possibly damaging Het
Col6a1 T C 10: 76,709,866 Y924C unknown Het
Crkl A G 16: 17,452,740 Y88C probably damaging Het
Cse1l T C 2: 166,919,621 F32L probably benign Het
Dmxl2 C T 9: 54,393,673 V2385I probably benign Het
Dnah1 T A 14: 31,268,027 I3219F probably damaging Het
Dnah17 C T 11: 118,025,549 R4266H probably benign Het
Efcab5 A G 11: 77,121,262 L722P probably damaging Het
Emilin3 C A 2: 160,909,185 V215L probably benign Het
Esr1 A T 10: 4,746,622 N157I possibly damaging Het
Esrrg A G 1: 188,198,707 M309V probably benign Het
Fam120b G A 17: 15,401,910 R50Q probably damaging Het
Fat2 G T 11: 55,310,303 Y648* probably null Het
Gbp2b T A 3: 142,603,653 I175N probably benign Het
Gm1043 T A 5: 37,154,608 probably benign Het
Gm21060 A G 19: 61,296,973 C33R possibly damaging Het
Gm9803 C T 10: 43,524,256 A30V probably benign Het
Gpx6 C T 13: 21,312,340 S28L probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifi44 T C 3: 151,749,558 Q10R probably benign Het
Impa2 T C 18: 67,318,428 V264A probably benign Het
Khdc1a A T 1: 21,350,884 M98L probably benign Het
Lrrc45 T A 11: 120,720,648 L616* probably null Het
Mios A T 6: 8,215,704 H300L probably benign Het
Mllt6 A T 11: 97,677,225 T827S probably damaging Het
Mrc1 C A 2: 14,316,901 D1068E probably benign Het
Ndst3 T C 3: 123,552,519 Y702C probably damaging Het
Nek11 T A 9: 105,204,888 probably null Het
Nek4 T C 14: 30,956,933 F138S probably damaging Het
Nfatc4 T A 14: 55,832,440 Y688* probably null Het
Nlrx1 C T 9: 44,263,760 V240M probably damaging Het
Npy6r A T 18: 44,276,082 Y190F probably benign Het
Olfr338 T G 2: 36,377,544 L256R probably damaging Het
Olfr472 A G 7: 107,903,413 E232G probably benign Het
Olfr509 A C 7: 108,646,226 S117A possibly damaging Het
Olfr548-ps1 C A 7: 102,542,610 R225S probably benign Het
Olfr780 A T 10: 129,322,369 T249S probably benign Het
Olfr960 T C 9: 39,623,341 F71L probably damaging Het
Osbpl7 A C 11: 97,052,261 H113P probably benign Het
Pck1 A G 2: 173,154,857 E188G probably benign Het
Pimreg A G 11: 72,045,750 D213G probably benign Het
Pkd1l2 A G 8: 117,043,237 I1160T probably damaging Het
Ppargc1b G A 18: 61,307,934 Q622* probably null Het
Ppfia2 T A 10: 106,906,477 C1044S probably damaging Het
Ppp4r3a A G 12: 101,058,400 V280A probably damaging Het
Ptprf T C 4: 118,211,048 N1764D probably benign Het
Pygm C T 19: 6,388,812 R311C possibly damaging Het
Rab7b A G 1: 131,698,561 K109R probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Sdccag3 T C 2: 26,386,971 D249G possibly damaging Het
Setbp1 T G 18: 78,857,711 I914L probably benign Het
Shprh A C 10: 11,151,991 Q114P probably benign Het
Slc5a9 T C 4: 111,885,528 I456V possibly damaging Het
Slc8b1 T C 5: 120,519,920 probably null Het
Spin1 T A 13: 51,139,516 Y87* probably null Het
Srebf2 T C 15: 82,177,276 probably null Het
Sufu T C 19: 46,475,539 Y397H probably damaging Het
Tgfb3 A C 12: 86,063,850 V242G probably benign Het
Tgm3 A T 2: 130,042,000 Y526F probably damaging Het
Tmem67 T C 4: 12,063,799 D454G probably benign Het
Ttn T C 2: 76,816,599 E3280G possibly damaging Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Umps A G 16: 33,962,138 V138A probably benign Het
Wdr66 C T 5: 123,274,204 T532M probably damaging Het
Ypel1 A G 16: 17,084,513 probably null Het
Zdhhc19 T A 16: 32,499,042 L63Q probably null Het
Other mutations in Tmem209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Tmem209 APN 6 30487417 missense probably damaging 0.99
IGL01068:Tmem209 APN 6 30502086 missense probably benign 0.18
IGL02106:Tmem209 APN 6 30508660 splice site probably null
IGL02109:Tmem209 APN 6 30497945 missense probably damaging 1.00
IGL02250:Tmem209 APN 6 30487388 missense probably damaging 1.00
R0012:Tmem209 UTSW 6 30502113 splice site probably benign
R0426:Tmem209 UTSW 6 30491182 missense probably damaging 0.99
R0452:Tmem209 UTSW 6 30487381 missense probably damaging 1.00
R0557:Tmem209 UTSW 6 30501914 missense probably damaging 0.99
R0690:Tmem209 UTSW 6 30505834 missense probably null 1.00
R1202:Tmem209 UTSW 6 30508790 missense probably benign 0.01
R1697:Tmem209 UTSW 6 30497868 missense probably benign 0.00
R3821:Tmem209 UTSW 6 30505960 missense probably damaging 1.00
R4795:Tmem209 UTSW 6 30501955 missense probably benign 0.00
R5131:Tmem209 UTSW 6 30497167 missense probably benign 0.00
R5715:Tmem209 UTSW 6 30497923 nonsense probably null
R6030:Tmem209 UTSW 6 30482968 missense probably damaging 1.00
R6153:Tmem209 UTSW 6 30505795 missense probably benign 0.01
R6181:Tmem209 UTSW 6 30505971 missense probably damaging 1.00
R6256:Tmem209 UTSW 6 30497167 missense probably benign 0.00
R6721:Tmem209 UTSW 6 30497175 missense probably benign 0.00
R6873:Tmem209 UTSW 6 30508456 missense probably damaging 1.00
R7062:Tmem209 UTSW 6 30502017 missense probably damaging 1.00
R7341:Tmem209 UTSW 6 30494795 missense probably benign 0.00
R7461:Tmem209 UTSW 6 30508470 nonsense probably null
R7790:Tmem209 UTSW 6 30497855 missense probably damaging 1.00
R8354:Tmem209 UTSW 6 30489309 missense probably damaging 0.97
R8454:Tmem209 UTSW 6 30489309 missense probably damaging 0.97
R8527:Tmem209 UTSW 6 30497238 missense probably damaging 1.00
R8542:Tmem209 UTSW 6 30497238 missense probably damaging 1.00
RF020:Tmem209 UTSW 6 30487418 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TATGCTCACAAGAAGCTCCC -3'
(R):5'- AGCACAGTTACTGAAGTAGTCATC -3'

Sequencing Primer
(F):5'- GCTCCCACAGCTTGTCTCCTG -3'
(R):5'- ATCATTACTTGAACTCACCTGCTGAG -3'
Posted On2017-08-16