Incidental Mutation 'R6030:Shprh'
ID486210
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene NameSNF2 histone linker PHD RING helicase
Synonyms2610103K11Rik, D230017O13Rik
MMRRC Submission 044202-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6030 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location11149427-11217595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 11151991 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 114 (Q114P)
Ref Sequence ENSEMBL: ENSMUSP00000125457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810]
Predicted Effect probably benign
Transcript: ENSMUST00000044053
AA Change: Q114P

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: Q114P

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054814
AA Change: Q114P

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: Q114P

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159541
AA Change: Q114P

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: Q114P

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159810
AA Change: Q114P

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: Q114P

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161858
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,255,733 W59R probably damaging Het
Abca16 A G 7: 120,533,798 N1317D probably benign Het
Abhd8 T A 8: 71,458,150 Y338F possibly damaging Het
Actg2 G T 6: 83,516,364 N297K probably damaging Het
Agap1 A G 1: 89,630,434 D148G probably damaging Het
Alox12 T C 11: 70,254,591 D52G possibly damaging Het
Ano5 T A 7: 51,574,825 S496T probably damaging Het
Arl6ip4 T C 5: 124,117,905 probably null Het
Atp4a G C 7: 30,722,516 E826Q probably damaging Het
Bbs7 T C 3: 36,602,911 D256G probably damaging Het
Bckdha T A 7: 25,631,441 D50V probably damaging Het
Cast A G 13: 74,695,937 S693P possibly damaging Het
Col6a1 T C 10: 76,709,866 Y924C unknown Het
Crkl A G 16: 17,452,740 Y88C probably damaging Het
Cse1l T C 2: 166,919,621 F32L probably benign Het
Dmxl2 C T 9: 54,393,673 V2385I probably benign Het
Dnah1 T A 14: 31,268,027 I3219F probably damaging Het
Dnah17 C T 11: 118,025,549 R4266H probably benign Het
Efcab5 A G 11: 77,121,262 L722P probably damaging Het
Emilin3 C A 2: 160,909,185 V215L probably benign Het
Esr1 A T 10: 4,746,622 N157I possibly damaging Het
Esrrg A G 1: 188,198,707 M309V probably benign Het
Fam120b G A 17: 15,401,910 R50Q probably damaging Het
Fat2 G T 11: 55,310,303 Y648* probably null Het
Gbp2b T A 3: 142,603,653 I175N probably benign Het
Gm1043 T A 5: 37,154,608 probably benign Het
Gm21060 A G 19: 61,296,973 C33R possibly damaging Het
Gm9803 C T 10: 43,524,256 A30V probably benign Het
Gpx6 C T 13: 21,312,340 S28L probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifi44 T C 3: 151,749,558 Q10R probably benign Het
Impa2 T C 18: 67,318,428 V264A probably benign Het
Khdc1a A T 1: 21,350,884 M98L probably benign Het
Lrrc45 T A 11: 120,720,648 L616* probably null Het
Mios A T 6: 8,215,704 H300L probably benign Het
Mllt6 A T 11: 97,677,225 T827S probably damaging Het
Mrc1 C A 2: 14,316,901 D1068E probably benign Het
Ndst3 T C 3: 123,552,519 Y702C probably damaging Het
Nek11 T A 9: 105,204,888 probably null Het
Nek4 T C 14: 30,956,933 F138S probably damaging Het
Nfatc4 T A 14: 55,832,440 Y688* probably null Het
Nlrx1 C T 9: 44,263,760 V240M probably damaging Het
Npy6r A T 18: 44,276,082 Y190F probably benign Het
Olfr338 T G 2: 36,377,544 L256R probably damaging Het
Olfr472 A G 7: 107,903,413 E232G probably benign Het
Olfr509 A C 7: 108,646,226 S117A possibly damaging Het
Olfr548-ps1 C A 7: 102,542,610 R225S probably benign Het
Olfr780 A T 10: 129,322,369 T249S probably benign Het
Olfr960 T C 9: 39,623,341 F71L probably damaging Het
Osbpl7 A C 11: 97,052,261 H113P probably benign Het
Pck1 A G 2: 173,154,857 E188G probably benign Het
Pimreg A G 11: 72,045,750 D213G probably benign Het
Pkd1l2 A G 8: 117,043,237 I1160T probably damaging Het
Ppargc1b G A 18: 61,307,934 Q622* probably null Het
Ppfia2 T A 10: 106,906,477 C1044S probably damaging Het
Ppp4r3a A G 12: 101,058,400 V280A probably damaging Het
Ptprf T C 4: 118,211,048 N1764D probably benign Het
Pygm C T 19: 6,388,812 R311C possibly damaging Het
Rab7b A G 1: 131,698,561 K109R probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Sdccag3 T C 2: 26,386,971 D249G possibly damaging Het
Setbp1 T G 18: 78,857,711 I914L probably benign Het
Slc5a9 T C 4: 111,885,528 I456V possibly damaging Het
Slc8b1 T C 5: 120,519,920 probably null Het
Spin1 T A 13: 51,139,516 Y87* probably null Het
Srebf2 T C 15: 82,177,276 probably null Het
Sufu T C 19: 46,475,539 Y397H probably damaging Het
Tgfb3 A C 12: 86,063,850 V242G probably benign Het
Tgm3 A T 2: 130,042,000 Y526F probably damaging Het
Tmem209 A G 6: 30,482,968 L508P probably damaging Het
Tmem67 T C 4: 12,063,799 D454G probably benign Het
Ttn T C 2: 76,816,599 E3280G possibly damaging Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Umps A G 16: 33,962,138 V138A probably benign Het
Wdr66 C T 5: 123,274,204 T532M probably damaging Het
Ypel1 A G 16: 17,084,513 probably null Het
Zdhhc19 T A 16: 32,499,042 L63Q probably null Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11188158 missense probably damaging 1.00
IGL00583:Shprh APN 10 11188020 missense probably benign 0.37
IGL00684:Shprh APN 10 11163037 missense probably benign 0.11
IGL01295:Shprh APN 10 11183868 missense probably damaging 0.96
IGL01387:Shprh APN 10 11170254 missense probably damaging 1.00
IGL01635:Shprh APN 10 11170019 nonsense probably null
IGL01833:Shprh APN 10 11191062 missense probably damaging 1.00
IGL02013:Shprh APN 10 11181502 splice site probably benign
IGL02502:Shprh APN 10 11194357 missense possibly damaging 0.66
IGL02819:Shprh APN 10 11154765 missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11192494 frame shift probably null
R0010:Shprh UTSW 10 11151931 missense probably benign
R0010:Shprh UTSW 10 11151931 missense probably benign
R0053:Shprh UTSW 10 11194372 splice site probably null
R0053:Shprh UTSW 10 11194372 splice site probably null
R0255:Shprh UTSW 10 11186391 missense possibly damaging 0.92
R0325:Shprh UTSW 10 11170109 missense probably benign 0.00
R0331:Shprh UTSW 10 11194170 splice site probably benign
R0494:Shprh UTSW 10 11157191 missense probably damaging 1.00
R0532:Shprh UTSW 10 11162812 missense possibly damaging 0.90
R0546:Shprh UTSW 10 11183887 splice site probably benign
R0574:Shprh UTSW 10 11163077 unclassified probably benign
R0605:Shprh UTSW 10 11207112 missense probably damaging 1.00
R0662:Shprh UTSW 10 11186847 missense probably damaging 1.00
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1263:Shprh UTSW 10 11159530 missense probably damaging 1.00
R1588:Shprh UTSW 10 11164744 missense probably damaging 1.00
R1638:Shprh UTSW 10 11157078 missense probably benign
R1830:Shprh UTSW 10 11186911 splice site probably null
R1898:Shprh UTSW 10 11186869 missense probably damaging 1.00
R1903:Shprh UTSW 10 11183797 nonsense probably null
R2060:Shprh UTSW 10 11152120 missense probably benign 0.03
R2225:Shprh UTSW 10 11162235 unclassified probably benign
R2363:Shprh UTSW 10 11171953 missense probably damaging 1.00
R2509:Shprh UTSW 10 11166724 missense probably damaging 1.00
R2891:Shprh UTSW 10 11164356 missense probably damaging 1.00
R3077:Shprh UTSW 10 11170413 missense probably damaging 1.00
R3150:Shprh UTSW 10 11170030 missense probably damaging 0.97
R3796:Shprh UTSW 10 11178757 missense possibly damaging 0.89
R4196:Shprh UTSW 10 11207860 utr 3 prime probably benign
R4423:Shprh UTSW 10 11186518 missense possibly damaging 0.82
R4488:Shprh UTSW 10 11160471 missense probably benign 0.17
R4748:Shprh UTSW 10 11170476 missense probably damaging 1.00
R4768:Shprh UTSW 10 11181540 missense probably damaging 0.96
R4867:Shprh UTSW 10 11164557 missense probably benign 0.00
R4937:Shprh UTSW 10 11157119 missense probably benign
R5140:Shprh UTSW 10 11154705 missense probably benign 0.03
R5318:Shprh UTSW 10 11166557 missense probably benign 0.04
R5323:Shprh UTSW 10 11170297 synonymous probably null
R5450:Shprh UTSW 10 11212330 missense possibly damaging 0.70
R5872:Shprh UTSW 10 11188073 missense probably damaging 1.00
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6392:Shprh UTSW 10 11178741 nonsense probably null
R6416:Shprh UTSW 10 11167873 missense probably damaging 1.00
R6470:Shprh UTSW 10 11171937 missense probably damaging 0.98
R6513:Shprh UTSW 10 11186893 missense probably damaging 1.00
R6530:Shprh UTSW 10 11194267 missense probably benign 0.02
R6678:Shprh UTSW 10 11166545 missense probably benign 0.16
R6757:Shprh UTSW 10 11181508 splice site probably null
R6971:Shprh UTSW 10 11166693 missense probably damaging 1.00
R7158:Shprh UTSW 10 11166730 missense probably damaging 0.98
V8831:Shprh UTSW 10 11186862 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATCGATGAAGGCCCTCCTG -3'
(R):5'- TCTGTAGCCAGGCCAAATCC -3'

Sequencing Primer
(F):5'- ATGAAGGCCCTCCTGAGAGTG -3'
(R):5'- CATGTCACTACTGAAGGAGGATTCC -3'
Posted On2017-08-16