Incidental Mutation 'R6031:Med23'
ID 486284
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Name mediator complex subunit 23
Synonyms ESTM7, 3000002A17Rik, X83317, Sur2, Crsp3, sno
MMRRC Submission 044203-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6031 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 24745889-24789358 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 24779646 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 542 (R542*)
Ref Sequence ENSEMBL: ENSMUSP00000135232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000020159
AA Change: R902*
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: R902*

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092646
AA Change: R908*
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: R908*

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176285
AA Change: R542*
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: R542*

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,214,084 (GRCm39) Y304H possibly damaging Het
Add2 A G 6: 86,075,655 (GRCm39) E268G probably damaging Het
Akr1b1 A C 6: 34,289,609 (GRCm39) V67G probably benign Het
Alms1 A T 6: 85,599,937 (GRCm39) N1588Y probably damaging Het
Arhgap23 A T 11: 97,366,965 (GRCm39) D1082V probably damaging Het
Asb6 A G 2: 30,714,207 (GRCm39) V301A probably benign Het
Ascc3 C T 10: 50,718,279 (GRCm39) R1991* probably null Het
Atg7 T A 6: 114,648,194 (GRCm39) C31S probably benign Het
Camsap2 A T 1: 136,208,176 (GRCm39) N1105K possibly damaging Het
Ccdc125 C T 13: 100,820,877 (GRCm39) probably null Het
Ccdc63 T C 5: 122,267,799 (GRCm39) I56V possibly damaging Het
Cpd T C 11: 76,681,714 (GRCm39) E1143G probably benign Het
Cpt1a T A 19: 3,421,556 (GRCm39) probably null Het
Creb3l2 A T 6: 37,311,369 (GRCm39) D473E probably benign Het
Disp2 G T 2: 118,620,275 (GRCm39) V336L probably benign Het
Efr3b A G 12: 4,017,106 (GRCm39) I782T possibly damaging Het
Fam98a A G 17: 75,846,427 (GRCm39) V230A probably damaging Het
Fat3 T A 9: 15,899,788 (GRCm39) T3082S probably benign Het
Frmd3 T C 4: 74,105,688 (GRCm39) Y445H probably damaging Het
Galt G A 4: 41,757,202 (GRCm39) R185Q probably benign Het
Gatb T C 3: 85,520,818 (GRCm39) I309T possibly damaging Het
Gfi1b G A 2: 28,503,820 (GRCm39) Q127* probably null Het
Gfpt1 C A 6: 87,063,302 (GRCm39) T563N probably damaging Het
Gria1 A G 11: 57,108,608 (GRCm39) D237G probably damaging Het
Hspbp1 A T 7: 4,666,465 (GRCm39) V305D probably benign Het
Hyls1 G A 9: 35,472,480 (GRCm39) S312F probably benign Het
Iars1 T C 13: 49,859,307 (GRCm39) V9A probably damaging Het
Ipo4 G A 14: 55,869,596 (GRCm39) P355S probably damaging Het
Jade2 G T 11: 51,717,413 (GRCm39) C314* probably null Het
Kri1 T C 9: 21,186,565 (GRCm39) E597G probably benign Het
Mcub A G 3: 129,720,038 (GRCm39) Y152H probably damaging Het
Ndc80 T C 17: 71,818,483 (GRCm39) N291S probably benign Het
Nop2 T C 6: 125,110,529 (GRCm39) probably null Het
Nrxn1 T C 17: 90,896,218 (GRCm39) N984S probably damaging Het
Ntm A C 9: 28,920,671 (GRCm39) L86R probably damaging Het
Numa1 T A 7: 101,661,219 (GRCm39) D1847E possibly damaging Het
Odf2l A G 3: 144,845,624 (GRCm39) Q334R probably damaging Het
Or10ak11 A T 4: 118,687,588 (GRCm39) probably null Het
Or2ag2 C T 7: 106,485,134 (GRCm39) V297I possibly damaging Het
Or4a39 T A 2: 89,237,316 (GRCm39) T36S probably damaging Het
Or5ac17 T C 16: 59,036,296 (GRCm39) R227G probably benign Het
Or6ae1 A T 7: 139,742,722 (GRCm39) V47E possibly damaging Het
Or6c203 A G 10: 129,010,224 (GRCm39) V222A probably benign Het
Pacc1 A G 1: 191,073,037 (GRCm39) R153G probably benign Het
Pcdhb19 A T 18: 37,630,776 (GRCm39) K190N probably damaging Het
Pdik1l A G 4: 134,006,352 (GRCm39) F197L probably damaging Het
Rnf113a2 T C 12: 84,464,764 (GRCm39) F219L probably damaging Het
Rnf208 A C 2: 25,133,776 (GRCm39) T157P probably damaging Het
RP23-145I16.3 A T 7: 141,930,451 (GRCm39) C364S probably damaging Het
Scn8a A T 15: 100,881,865 (GRCm39) D644V probably damaging Het
Thbs3 T A 3: 89,125,401 (GRCm39) C204S probably damaging Het
Tlr3 A G 8: 45,851,565 (GRCm39) I444T probably damaging Het
Trpm8 A T 1: 88,282,191 (GRCm39) I696F possibly damaging Het
Ttn A T 2: 76,660,941 (GRCm39) V7422D possibly damaging Het
Ufl1 A G 4: 25,278,038 (GRCm39) V139A probably benign Het
Uggt2 A T 14: 119,308,238 (GRCm39) V381D probably benign Het
Vgll3 T A 16: 65,636,367 (GRCm39) Y173N probably damaging Het
Vmn1r9 A G 6: 57,048,158 (GRCm39) T78A probably benign Het
Vps13b T A 15: 35,472,114 (GRCm39) L806M probably damaging Het
Vps13d A C 4: 144,895,079 (GRCm39) H394Q probably benign Het
Wdr53 T A 16: 32,075,536 (GRCm39) V247D probably damaging Het
Wdr81 A T 11: 75,338,695 (GRCm39) L1488Q probably damaging Het
Zc3h6 A G 2: 128,809,732 (GRCm39) D3G possibly damaging Het
Zfp93 G T 7: 23,975,725 (GRCm39) C570F probably damaging Het
Zfp943 C T 17: 22,212,357 (GRCm39) T481I probably benign Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24,764,482 (GRCm39) missense probably damaging 1.00
IGL00792:Med23 APN 10 24,752,902 (GRCm39) missense possibly damaging 0.93
IGL01289:Med23 APN 10 24,778,019 (GRCm39) missense probably damaging 1.00
IGL01469:Med23 APN 10 24,758,495 (GRCm39) missense probably damaging 1.00
IGL01598:Med23 APN 10 24,779,696 (GRCm39) missense probably benign 0.34
IGL02324:Med23 APN 10 24,773,239 (GRCm39) missense probably damaging 0.98
IGL02381:Med23 APN 10 24,776,626 (GRCm39) missense possibly damaging 0.95
IGL02465:Med23 APN 10 24,779,641 (GRCm39) missense probably damaging 0.96
IGL02554:Med23 APN 10 24,774,473 (GRCm39) critical splice donor site probably null
IGL02683:Med23 APN 10 24,746,615 (GRCm39) missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24,750,469 (GRCm39) missense probably benign 0.01
R0080:Med23 UTSW 10 24,788,715 (GRCm39) missense probably benign 0.33
R0125:Med23 UTSW 10 24,776,686 (GRCm39) missense probably damaging 1.00
R0311:Med23 UTSW 10 24,773,256 (GRCm39) missense possibly damaging 0.95
R0765:Med23 UTSW 10 24,776,608 (GRCm39) missense probably damaging 1.00
R1302:Med23 UTSW 10 24,764,320 (GRCm39) splice site probably null
R1456:Med23 UTSW 10 24,779,550 (GRCm39) splice site probably benign
R1514:Med23 UTSW 10 24,768,565 (GRCm39) splice site probably benign
R1774:Med23 UTSW 10 24,779,584 (GRCm39) missense probably damaging 1.00
R1851:Med23 UTSW 10 24,786,768 (GRCm39) splice site probably null
R1928:Med23 UTSW 10 24,785,710 (GRCm39) missense probably benign
R1975:Med23 UTSW 10 24,786,664 (GRCm39) missense probably benign 0.01
R2011:Med23 UTSW 10 24,755,653 (GRCm39) missense possibly damaging 0.63
R2266:Med23 UTSW 10 24,750,499 (GRCm39) missense probably benign 0.00
R2309:Med23 UTSW 10 24,746,586 (GRCm39) missense probably damaging 0.99
R2507:Med23 UTSW 10 24,786,711 (GRCm39) missense probably damaging 1.00
R2566:Med23 UTSW 10 24,764,473 (GRCm39) missense probably damaging 1.00
R3720:Med23 UTSW 10 24,767,018 (GRCm39) missense probably damaging 1.00
R3771:Med23 UTSW 10 24,778,099 (GRCm39) missense probably damaging 1.00
R3811:Med23 UTSW 10 24,768,491 (GRCm39) splice site probably null
R3811:Med23 UTSW 10 24,768,490 (GRCm39) nonsense probably null
R4305:Med23 UTSW 10 24,780,168 (GRCm39) nonsense probably null
R4323:Med23 UTSW 10 24,746,603 (GRCm39) missense probably benign 0.02
R4701:Med23 UTSW 10 24,769,546 (GRCm39) missense probably damaging 1.00
R4886:Med23 UTSW 10 24,750,581 (GRCm39) critical splice donor site probably null
R4925:Med23 UTSW 10 24,786,645 (GRCm39) missense probably damaging 1.00
R4943:Med23 UTSW 10 24,751,567 (GRCm39) missense possibly damaging 0.92
R5207:Med23 UTSW 10 24,771,734 (GRCm39) nonsense probably null
R5749:Med23 UTSW 10 24,764,347 (GRCm39) missense possibly damaging 0.84
R5806:Med23 UTSW 10 24,783,119 (GRCm39) missense probably damaging 1.00
R5896:Med23 UTSW 10 24,778,043 (GRCm39) missense probably damaging 1.00
R5954:Med23 UTSW 10 24,746,381 (GRCm39) splice site probably benign
R6031:Med23 UTSW 10 24,779,646 (GRCm39) nonsense probably null
R6093:Med23 UTSW 10 24,754,341 (GRCm39) missense probably benign 0.16
R6107:Med23 UTSW 10 24,781,932 (GRCm39) nonsense probably null
R6356:Med23 UTSW 10 24,764,311 (GRCm39) missense probably damaging 0.98
R6393:Med23 UTSW 10 24,749,374 (GRCm39) missense possibly damaging 0.91
R6533:Med23 UTSW 10 24,769,518 (GRCm39) missense probably damaging 1.00
R6911:Med23 UTSW 10 24,778,079 (GRCm39) missense probably damaging 0.98
R6981:Med23 UTSW 10 24,771,722 (GRCm39) missense possibly damaging 0.92
R7085:Med23 UTSW 10 24,746,019 (GRCm39) missense probably damaging 1.00
R7215:Med23 UTSW 10 24,764,327 (GRCm39) missense probably benign
R7229:Med23 UTSW 10 24,777,902 (GRCm39) missense probably benign
R7489:Med23 UTSW 10 24,780,254 (GRCm39) missense probably damaging 1.00
R7530:Med23 UTSW 10 24,781,851 (GRCm39) missense probably benign 0.00
R7643:Med23 UTSW 10 24,781,863 (GRCm39) missense probably benign 0.01
R7653:Med23 UTSW 10 24,780,282 (GRCm39) missense probably damaging 1.00
R7764:Med23 UTSW 10 24,785,818 (GRCm39) critical splice donor site probably null
R7784:Med23 UTSW 10 24,778,346 (GRCm39) missense probably damaging 1.00
R8024:Med23 UTSW 10 24,755,581 (GRCm39) missense possibly damaging 0.74
R8182:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R8412:Med23 UTSW 10 24,784,632 (GRCm39) missense probably benign 0.01
R8874:Med23 UTSW 10 24,771,617 (GRCm39) missense possibly damaging 0.92
R8975:Med23 UTSW 10 24,780,334 (GRCm39) missense probably benign 0.42
R9131:Med23 UTSW 10 24,780,279 (GRCm39) missense
R9202:Med23 UTSW 10 24,780,202 (GRCm39) missense probably benign 0.12
R9341:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R9342:Med23 UTSW 10 24,750,469 (GRCm39) missense probably benign 0.01
R9343:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R9412:Med23 UTSW 10 24,778,019 (GRCm39) missense probably damaging 1.00
RF003:Med23 UTSW 10 24,779,683 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTTTAGGAGCGATGAAAGATTG -3'
(R):5'- AACTCGCTGTGGGTCTGTAC -3'

Sequencing Primer
(F):5'- GGTTTGGGGTAGACTAGACATCTAAG -3'
(R):5'- TGGGTCTGTACAGAGGCC -3'
Posted On 2017-08-16