Incidental Mutation 'R6031:Rnf113a2'
ID 486293
Institutional Source Beutler Lab
Gene Symbol Rnf113a2
Ensembl Gene ENSMUSG00000098134
Gene Name ring finger protein 113A2
Synonyms 2310020H19Rik
MMRRC Submission 044203-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock # R6031 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 84417196-84418578 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84417990 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 219 (F219L)
Ref Sequence ENSEMBL: ENSMUSP00000138536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081828] [ENSMUST00000151789] [ENSMUST00000153540] [ENSMUST00000183146]
AlphaFold Q14B01
Predicted Effect probably benign
Transcript: ENSMUST00000081828
SMART Domains Protein: ENSMUSP00000080512
Gene: ENSMUSG00000057265

DomainStartEndE-ValueType
low complexity region 4 29 N/A INTRINSIC
Pfam:DUF4515 83 276 1.8e-44 PFAM
coiled coil region 277 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151789
SMART Domains Protein: ENSMUSP00000115708
Gene: ENSMUSG00000057265

DomainStartEndE-ValueType
Pfam:DUF4515 1 138 6.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153540
SMART Domains Protein: ENSMUSP00000114625
Gene: ENSMUSG00000057265

DomainStartEndE-ValueType
Pfam:DUF4515 1 105 3.9e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183146
AA Change: F219L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138536
Gene: ENSMUSG00000098134
AA Change: F219L

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
ZnF_C3H1 196 223 1.8e-7 SMART
RING 262 299 4.05e-5 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a protein which contains a C3H1-type zinc finger domain and a C3HC4 Ring-type (Really Interesting New Gene-type) zinc finger domain. The Ring-type zinc finger domain is identified in various tumor suppressors, DNA repair genes and cytokine receptor-associated molecules, and is probably involved in mediating protein-protein interactions. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,252 Y304H possibly damaging Het
Add2 A G 6: 86,098,673 E268G probably damaging Het
Akr1b3 A C 6: 34,312,674 V67G probably benign Het
Alms1 A T 6: 85,622,955 N1588Y probably damaging Het
Arhgap23 A T 11: 97,476,139 D1082V probably damaging Het
Asb6 A G 2: 30,824,195 V301A probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Atg7 T A 6: 114,671,233 C31S probably benign Het
Camsap2 A T 1: 136,280,438 N1105K possibly damaging Het
Ccdc109b A G 3: 129,926,389 Y152H probably damaging Het
Ccdc125 C T 13: 100,684,369 probably null Het
Ccdc63 T C 5: 122,129,736 I56V possibly damaging Het
Cpd T C 11: 76,790,888 E1143G probably benign Het
Cpt1a T A 19: 3,371,556 probably null Het
Creb3l2 A T 6: 37,334,434 D473E probably benign Het
Disp2 G T 2: 118,789,794 V336L probably benign Het
Efr3b A G 12: 3,967,106 I782T possibly damaging Het
Fam98a A G 17: 75,539,432 V230A probably damaging Het
Fat3 T A 9: 15,988,492 T3082S probably benign Het
Frmd3 T C 4: 74,187,451 Y445H probably damaging Het
Galt G A 4: 41,757,202 R185Q probably benign Het
Gatb T C 3: 85,613,511 I309T possibly damaging Het
Gfi1b G A 2: 28,613,808 Q127* probably null Het
Gfpt1 C A 6: 87,086,320 T563N probably damaging Het
Gria1 A G 11: 57,217,782 D237G probably damaging Het
Hspbp1 A T 7: 4,663,466 V305D probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Iars T C 13: 49,705,831 V9A probably damaging Het
Ipo4 G A 14: 55,632,139 P355S probably damaging Het
Jade2 G T 11: 51,826,586 C314* probably null Het
Kri1 T C 9: 21,275,269 E597G probably benign Het
Med23 C T 10: 24,903,748 R542* probably null Het
Ndc80 T C 17: 71,511,488 N291S probably benign Het
Nop2 T C 6: 125,133,566 probably null Het
Nrxn1 T C 17: 90,588,790 N984S probably damaging Het
Ntm A C 9: 29,009,375 L86R probably damaging Het
Numa1 T A 7: 102,012,012 D1847E possibly damaging Het
Odf2l A G 3: 145,139,863 Q334R probably damaging Het
Olfr1238 T A 2: 89,406,972 T36S probably damaging Het
Olfr1333 A T 4: 118,830,391 probably null Het
Olfr199 T C 16: 59,215,933 R227G probably benign Het
Olfr522 A T 7: 140,162,809 V47E possibly damaging Het
Olfr706 C T 7: 106,885,927 V297I possibly damaging Het
Olfr772 A G 10: 129,174,355 V222A probably benign Het
Pcdhb19 A T 18: 37,497,723 K190N probably damaging Het
Pdik1l A G 4: 134,279,041 F197L probably damaging Het
Rnf208 A C 2: 25,243,764 T157P probably damaging Het
RP23-145I16.3 A T 7: 142,376,714 C364S probably damaging Het
Scn8a A T 15: 100,983,984 D644V probably damaging Het
Thbs3 T A 3: 89,218,094 C204S probably damaging Het
Tlr3 A G 8: 45,398,528 I444T probably damaging Het
Tmem206 A G 1: 191,340,840 R153G probably benign Het
Trpm8 A T 1: 88,354,469 I696F possibly damaging Het
Ttn A T 2: 76,830,597 V7422D possibly damaging Het
Ufl1 A G 4: 25,278,038 V139A probably benign Het
Uggt2 A T 14: 119,070,826 V381D probably benign Het
Vgll3 T A 16: 65,839,481 Y173N probably damaging Het
Vmn1r9 A G 6: 57,071,173 T78A probably benign Het
Vps13b T A 15: 35,471,968 L806M probably damaging Het
Vps13d A C 4: 145,168,509 H394Q probably benign Het
Wdr53 T A 16: 32,256,718 V247D probably damaging Het
Wdr81 A T 11: 75,447,869 L1488Q probably damaging Het
Zc3h6 A G 2: 128,967,812 D3G possibly damaging Het
Zfp93 G T 7: 24,276,300 C570F probably damaging Het
Zfp943 C T 17: 21,993,376 T481I probably benign Het
Other mutations in Rnf113a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03059:Rnf113a2 APN 12 84417476 missense possibly damaging 0.69
IGL03123:Rnf113a2 APN 12 84418276 missense probably benign 0.21
R4826:Rnf113a2 UTSW 12 84417614 missense probably benign
R5194:Rnf113a2 UTSW 12 84417337 start codon destroyed probably null 0.08
R6031:Rnf113a2 UTSW 12 84417990 missense probably damaging 1.00
R7102:Rnf113a2 UTSW 12 84417771 missense probably damaging 1.00
R7246:Rnf113a2 UTSW 12 84417677 missense possibly damaging 0.81
R7307:Rnf113a2 UTSW 12 84418179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGCAGTCAGAAAATCCAGG -3'
(R):5'- GTGACAACCGGATTCTGGAAGG -3'

Sequencing Primer
(F):5'- GAGGATGACAAAATCTATCGTGG -3'
(R):5'- GTTTGGCGACAGATGAAACATTTG -3'
Posted On 2017-08-16