Mutagenetix > Incidental Mutations

Incidental Mutation 'R6031:Iars'

486294

Institutional Source

Beutler Lab

Gene Symbol

Iars

Ensembl Gene

ENSMUSG00000037851

Gene Name

isoleucine-tRNA synthetase

Synonyms

E430001P04Rik, 2510016L12Rik

MMRRC Submission

044203-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6031 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

49682100-49734267 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 49705831 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 9 (V9A)

Ref Sequence

ENSEMBL: ENSMUSP00000130204 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047363] [ENSMUST00000164260] [ENSMUST00000165316] [ENSMUST00000171510]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047363
AA Change: V417A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000048096
Gene: ENSMUSG00000037851
AA Change: V417A

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	17	639	9.2e-242	PFAM
Pfam:tRNA-synt_1g	46	197	3.7e-6	PFAM
Pfam:Anticodon_1	693	852	1.1e-23	PFAM
low complexity region	1159	1167	N/A	INTRINSIC
low complexity region	1169	1180	N/A	INTRINSIC
low complexity region	1220	1229	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164260
AA Change: V417A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126806
Gene: ENSMUSG00000037851
AA Change: V417A

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	17	639	5.5e-238	PFAM
Pfam:tRNA-synt_1g	46	205	5.2e-8	PFAM
Pfam:tRNA-synt_1g	521	659	2.1e-5	PFAM
Pfam:Anticodon_1	693	852	7.1e-24	PFAM
low complexity region	1159	1167	N/A	INTRINSIC
low complexity region	1169	1180	N/A	INTRINSIC
low complexity region	1220	1229	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164275

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165063

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165316
AA Change: V417A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000132082
Gene: ENSMUSG00000037851
AA Change: V417A

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	17	639	5.5e-238	PFAM
Pfam:tRNA-synt_1g	46	205	5.2e-8	PFAM
Pfam:tRNA-synt_1g	521	659	2.1e-5	PFAM
Pfam:Anticodon_1	693	852	7.1e-24	PFAM
low complexity region	1159	1167	N/A	INTRINSIC
low complexity region	1169	1180	N/A	INTRINSIC
low complexity region	1220	1229	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000171510
AA Change: V9A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000130204
Gene: ENSMUSG00000037851
AA Change: V9A

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	1	96	5.6e-28	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Isoleucine-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family and has been identified as a target of autoantibodies in the autoimmune disease polymyositis/dermatomyositis. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	C	17: 8,995,252	Y304H	possibly damaging	Het
Add2	A	G	6: 86,098,673	E268G	probably damaging	Het
Akr1b3	A	C	6: 34,312,674	V67G	probably benign	Het
Alms1	A	T	6: 85,622,955	N1588Y	probably damaging	Het
Arhgap23	A	T	11: 97,476,139	D1082V	probably damaging	Het
Asb6	A	G	2: 30,824,195	V301A	probably benign	Het
Ascc3	C	T	10: 50,842,183	R1991*	probably null	Het
Atg7	T	A	6: 114,671,233	C31S	probably benign	Het
Camsap2	A	T	1: 136,280,438	N1105K	possibly damaging	Het
Ccdc109b	A	G	3: 129,926,389	Y152H	probably damaging	Het
Ccdc125	C	T	13: 100,684,369		probably null	Het
Ccdc63	T	C	5: 122,129,736	I56V	possibly damaging	Het
Cpd	T	C	11: 76,790,888	E1143G	probably benign	Het
Cpt1a	T	A	19: 3,371,556		probably null	Het
Creb3l2	A	T	6: 37,334,434	D473E	probably benign	Het
Disp2	G	T	2: 118,789,794	V336L	probably benign	Het
Efr3b	A	G	12: 3,967,106	I782T	possibly damaging	Het
Fam98a	A	G	17: 75,539,432	V230A	probably damaging	Het
Fat3	T	A	9: 15,988,492	T3082S	probably benign	Het
Frmd3	T	C	4: 74,187,451	Y445H	probably damaging	Het
Galt	G	A	4: 41,757,202	R185Q	probably benign	Het
Gatb	T	C	3: 85,613,511	I309T	possibly damaging	Het
Gfi1b	G	A	2: 28,613,808	Q127*	probably null	Het
Gfpt1	C	A	6: 87,086,320	T563N	probably damaging	Het
Gria1	A	G	11: 57,217,782	D237G	probably damaging	Het
Hspbp1	A	T	7: 4,663,466	V305D	probably benign	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Ipo4	G	A	14: 55,632,139	P355S	probably damaging	Het
Jade2	G	T	11: 51,826,586	C314*	probably null	Het
Kri1	T	C	9: 21,275,269	E597G	probably benign	Het
Med23	C	T	10: 24,903,748	R542*	probably null	Het
Ndc80	T	C	17: 71,511,488	N291S	probably benign	Het
Nop2	T	C	6: 125,133,566		probably null	Het
Nrxn1	T	C	17: 90,588,790	N984S	probably damaging	Het
Ntm	A	C	9: 29,009,375	L86R	probably damaging	Het
Numa1	T	A	7: 102,012,012	D1847E	possibly damaging	Het
Odf2l	A	G	3: 145,139,863	Q334R	probably damaging	Het
Olfr1238	T	A	2: 89,406,972	T36S	probably damaging	Het
Olfr1333	A	T	4: 118,830,391		probably null	Het
Olfr199	T	C	16: 59,215,933	R227G	probably benign	Het
Olfr522	A	T	7: 140,162,809	V47E	possibly damaging	Het
Olfr706	C	T	7: 106,885,927	V297I	possibly damaging	Het
Olfr772	A	G	10: 129,174,355	V222A	probably benign	Het
Pcdhb19	A	T	18: 37,497,723	K190N	probably damaging	Het
Pdik1l	A	G	4: 134,279,041	F197L	probably damaging	Het
Rnf113a2	T	C	12: 84,417,990	F219L	probably damaging	Het
Rnf208	A	C	2: 25,243,764	T157P	probably damaging	Het
RP23-145I16.3	A	T	7: 142,376,714	C364S	probably damaging	Het
Scn8a	A	T	15: 100,983,984	D644V	probably damaging	Het
Thbs3	T	A	3: 89,218,094	C204S	probably damaging	Het
Tlr3	A	G	8: 45,398,528	I444T	probably damaging	Het
Tmem206	A	G	1: 191,340,840	R153G	probably benign	Het
Trpm8	A	T	1: 88,354,469	I696F	possibly damaging	Het
Ttn	A	T	2: 76,830,597	V7422D	possibly damaging	Het
Ufl1	A	G	4: 25,278,038	V139A	probably benign	Het
Uggt2	A	T	14: 119,070,826	V381D	probably benign	Het
Vgll3	T	A	16: 65,839,481	Y173N	probably damaging	Het
Vmn1r9	A	G	6: 57,071,173	T78A	probably benign	Het
Vps13b	T	A	15: 35,471,968	L806M	probably damaging	Het
Vps13d	A	C	4: 145,168,509	H394Q	probably benign	Het
Wdr53	T	A	16: 32,256,718	V247D	probably damaging	Het
Wdr81	A	T	11: 75,447,869	L1488Q	probably damaging	Het
Zc3h6	A	G	2: 128,967,812	D3G	possibly damaging	Het
Zfp93	G	T	7: 24,276,300	C570F	probably damaging	Het
Zfp943	C	T	17: 21,993,376	T481I	probably benign	Het

Other mutations in Iars

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00697:Iars	APN	13	49709728	missense	probably damaging	1.00
IGL00764:Iars	APN	13	49711827	missense	probably benign	0.34
IGL01153:Iars	APN	13	49711805	missense	probably damaging	1.00
IGL01481:Iars	APN	13	49728698	missense	probably benign	0.00
IGL01596:Iars	APN	13	49703176	missense	probably benign
IGL01682:Iars	APN	13	49709658	missense	probably damaging	1.00
IGL01885:Iars	APN	13	49691499	missense	probably benign	0.25
IGL01907:Iars	APN	13	49709655	missense	probably damaging	1.00
IGL02023:Iars	APN	13	49688249	missense	probably damaging	1.00
IGL02121:Iars	APN	13	49724696	missense	probably benign	0.00
IGL02365:Iars	APN	13	49691499	missense	probably benign	0.25
IGL02704:Iars	APN	13	49721100	missense	probably damaging	1.00
IGL02838:Iars	APN	13	49690489	missense	possibly damaging	0.87
IGL02975:Iars	APN	13	49704849	missense	probably damaging	1.00
IGL02982:Iars	APN	13	49709709	missense	probably benign	0.00
IGL03034:Iars	APN	13	49690489	missense	possibly damaging	0.87
IGL03060:Iars	APN	13	49690447	critical splice acceptor site	probably null
IGL03156:Iars	APN	13	49703179	missense	possibly damaging	0.87
IGL03206:Iars	APN	13	49693070	missense	possibly damaging	0.81
IGL03343:Iars	APN	13	49724747	missense	probably benign	0.12
gannett_peak	UTSW	13	49708421	missense	probably damaging	1.00
wind_river	UTSW	13	49701895	missense	probably damaging	1.00
R0054:Iars	UTSW	13	49693135	missense	probably damaging	1.00
R0054:Iars	UTSW	13	49693135	missense	probably damaging	1.00
R0184:Iars	UTSW	13	49722212	missense	probably benign	0.00
R0200:Iars	UTSW	13	49726202	missense	possibly damaging	0.62
R0356:Iars	UTSW	13	49703233	missense	probably benign	0.03
R0383:Iars	UTSW	13	49732342	missense	probably damaging	0.99
R0657:Iars	UTSW	13	49702519	missense	probably damaging	1.00
R1005:Iars	UTSW	13	49687445	missense	possibly damaging	0.94
R1427:Iars	UTSW	13	49704269	critical splice acceptor site	probably null
R1449:Iars	UTSW	13	49733710	missense	probably damaging	0.99
R1647:Iars	UTSW	13	49723002	missense	possibly damaging	0.85
R1648:Iars	UTSW	13	49723002	missense	possibly damaging	0.85
R1664:Iars	UTSW	13	49711775	missense	probably damaging	0.98
R1763:Iars	UTSW	13	49723077	critical splice donor site	probably null
R2192:Iars	UTSW	13	49688129	intron	probably null
R2203:Iars	UTSW	13	49722675	missense	probably benign	0.00
R2357:Iars	UTSW	13	49688203	missense	probably damaging	1.00
R3724:Iars	UTSW	13	49687384	critical splice acceptor site	probably null
R4785:Iars	UTSW	13	49724663	missense	probably damaging	0.99
R4934:Iars	UTSW	13	49717984	missense	probably benign	0.17
R4999:Iars	UTSW	13	49709661	missense	probably damaging	1.00
R5048:Iars	UTSW	13	49688237	missense	probably damaging	0.99
R5268:Iars	UTSW	13	49690491	missense	probably damaging	1.00
R5394:Iars	UTSW	13	49722165	missense	probably damaging	1.00
R5486:Iars	UTSW	13	49709573	splice site	probably null
R5960:Iars	UTSW	13	49724637	missense	possibly damaging	0.68
R5972:Iars	UTSW	13	49709632	missense	possibly damaging	0.91
R5978:Iars	UTSW	13	49722993	missense	probably damaging	0.99
R6031:Iars	UTSW	13	49705831	missense	probably damaging	0.98
R6092:Iars	UTSW	13	49708421	missense	probably damaging	1.00
R6167:Iars	UTSW	13	49722714	missense	probably damaging	1.00
R6313:Iars	UTSW	13	49708445	missense	probably damaging	0.99
R6358:Iars	UTSW	13	49727143	missense	possibly damaging	0.67
R6385:Iars	UTSW	13	49701895	missense	probably damaging	1.00
R6403:Iars	UTSW	13	49687495	missense	probably damaging	1.00
R6575:Iars	UTSW	13	49725269	missense	probably damaging	1.00
R6675:Iars	UTSW	13	49719578	missense	probably damaging	0.99
R6957:Iars	UTSW	13	49722161	missense	probably damaging	1.00
R7207:Iars	UTSW	13	49688315	critical splice donor site	probably null
R7254:Iars	UTSW	13	49723078	critical splice donor site	probably null
R7354:Iars	UTSW	13	49704320	missense	probably benign
R7397:Iars	UTSW	13	49728677	missense	probably benign	0.00
R7696:Iars	UTSW	13	49706738	missense	probably damaging	1.00
R7799:Iars	UTSW	13	49723018	missense	probably damaging	1.00
R7828:Iars	UTSW	13	49725272	missense	probably benign
Z1088:Iars	UTSW	13	49721088	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAGGCATCTGCTGATCTGG -3'
(R):5'- GCAGATGTTACTTTAGCTGTATGTGAC -3'

Sequencing Primer
(F):5'- TGCTGATCTGGACACTTGTAATC -3'
(R):5'- AGCTGTATGTGACTGTGTCTTCC -3'

Posted On

2017-08-16