Incidental Mutation 'R6031:Iars'
ID486294
Institutional Source Beutler Lab
Gene Symbol Iars
Ensembl Gene ENSMUSG00000037851
Gene Nameisoleucine-tRNA synthetase
SynonymsE430001P04Rik, 2510016L12Rik
MMRRC Submission 044203-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6031 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location49682100-49734267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49705831 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 9 (V9A)
Ref Sequence ENSEMBL: ENSMUSP00000130204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047363] [ENSMUST00000164260] [ENSMUST00000165316] [ENSMUST00000171510]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047363
AA Change: V417A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048096
Gene: ENSMUSG00000037851
AA Change: V417A

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 17 639 9.2e-242 PFAM
Pfam:tRNA-synt_1g 46 197 3.7e-6 PFAM
Pfam:Anticodon_1 693 852 1.1e-23 PFAM
low complexity region 1159 1167 N/A INTRINSIC
low complexity region 1169 1180 N/A INTRINSIC
low complexity region 1220 1229 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164260
AA Change: V417A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126806
Gene: ENSMUSG00000037851
AA Change: V417A

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 17 639 5.5e-238 PFAM
Pfam:tRNA-synt_1g 46 205 5.2e-8 PFAM
Pfam:tRNA-synt_1g 521 659 2.1e-5 PFAM
Pfam:Anticodon_1 693 852 7.1e-24 PFAM
low complexity region 1159 1167 N/A INTRINSIC
low complexity region 1169 1180 N/A INTRINSIC
low complexity region 1220 1229 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165063
Predicted Effect possibly damaging
Transcript: ENSMUST00000165316
AA Change: V417A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132082
Gene: ENSMUSG00000037851
AA Change: V417A

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 17 639 5.5e-238 PFAM
Pfam:tRNA-synt_1g 46 205 5.2e-8 PFAM
Pfam:tRNA-synt_1g 521 659 2.1e-5 PFAM
Pfam:Anticodon_1 693 852 7.1e-24 PFAM
low complexity region 1159 1167 N/A INTRINSIC
low complexity region 1169 1180 N/A INTRINSIC
low complexity region 1220 1229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171510
AA Change: V9A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130204
Gene: ENSMUSG00000037851
AA Change: V9A

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 1 96 5.6e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Isoleucine-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family and has been identified as a target of autoantibodies in the autoimmune disease polymyositis/dermatomyositis. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,252 Y304H possibly damaging Het
Add2 A G 6: 86,098,673 E268G probably damaging Het
Akr1b3 A C 6: 34,312,674 V67G probably benign Het
Alms1 A T 6: 85,622,955 N1588Y probably damaging Het
Arhgap23 A T 11: 97,476,139 D1082V probably damaging Het
Asb6 A G 2: 30,824,195 V301A probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Atg7 T A 6: 114,671,233 C31S probably benign Het
Camsap2 A T 1: 136,280,438 N1105K possibly damaging Het
Ccdc109b A G 3: 129,926,389 Y152H probably damaging Het
Ccdc125 C T 13: 100,684,369 probably null Het
Ccdc63 T C 5: 122,129,736 I56V possibly damaging Het
Cpd T C 11: 76,790,888 E1143G probably benign Het
Cpt1a T A 19: 3,371,556 probably null Het
Creb3l2 A T 6: 37,334,434 D473E probably benign Het
Disp2 G T 2: 118,789,794 V336L probably benign Het
Efr3b A G 12: 3,967,106 I782T possibly damaging Het
Fam98a A G 17: 75,539,432 V230A probably damaging Het
Fat3 T A 9: 15,988,492 T3082S probably benign Het
Frmd3 T C 4: 74,187,451 Y445H probably damaging Het
Galt G A 4: 41,757,202 R185Q probably benign Het
Gatb T C 3: 85,613,511 I309T possibly damaging Het
Gfi1b G A 2: 28,613,808 Q127* probably null Het
Gfpt1 C A 6: 87,086,320 T563N probably damaging Het
Gria1 A G 11: 57,217,782 D237G probably damaging Het
Hspbp1 A T 7: 4,663,466 V305D probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ipo4 G A 14: 55,632,139 P355S probably damaging Het
Jade2 G T 11: 51,826,586 C314* probably null Het
Kri1 T C 9: 21,275,269 E597G probably benign Het
Med23 C T 10: 24,903,748 R542* probably null Het
Ndc80 T C 17: 71,511,488 N291S probably benign Het
Nop2 T C 6: 125,133,566 probably null Het
Nrxn1 T C 17: 90,588,790 N984S probably damaging Het
Ntm A C 9: 29,009,375 L86R probably damaging Het
Numa1 T A 7: 102,012,012 D1847E possibly damaging Het
Odf2l A G 3: 145,139,863 Q334R probably damaging Het
Olfr1238 T A 2: 89,406,972 T36S probably damaging Het
Olfr1333 A T 4: 118,830,391 probably null Het
Olfr199 T C 16: 59,215,933 R227G probably benign Het
Olfr522 A T 7: 140,162,809 V47E possibly damaging Het
Olfr706 C T 7: 106,885,927 V297I possibly damaging Het
Olfr772 A G 10: 129,174,355 V222A probably benign Het
Pcdhb19 A T 18: 37,497,723 K190N probably damaging Het
Pdik1l A G 4: 134,279,041 F197L probably damaging Het
Rnf113a2 T C 12: 84,417,990 F219L probably damaging Het
Rnf208 A C 2: 25,243,764 T157P probably damaging Het
RP23-145I16.3 A T 7: 142,376,714 C364S probably damaging Het
Scn8a A T 15: 100,983,984 D644V probably damaging Het
Thbs3 T A 3: 89,218,094 C204S probably damaging Het
Tlr3 A G 8: 45,398,528 I444T probably damaging Het
Tmem206 A G 1: 191,340,840 R153G probably benign Het
Trpm8 A T 1: 88,354,469 I696F possibly damaging Het
Ttn A T 2: 76,830,597 V7422D possibly damaging Het
Ufl1 A G 4: 25,278,038 V139A probably benign Het
Uggt2 A T 14: 119,070,826 V381D probably benign Het
Vgll3 T A 16: 65,839,481 Y173N probably damaging Het
Vmn1r9 A G 6: 57,071,173 T78A probably benign Het
Vps13b T A 15: 35,471,968 L806M probably damaging Het
Vps13d A C 4: 145,168,509 H394Q probably benign Het
Wdr53 T A 16: 32,256,718 V247D probably damaging Het
Wdr81 A T 11: 75,447,869 L1488Q probably damaging Het
Zc3h6 A G 2: 128,967,812 D3G possibly damaging Het
Zfp93 G T 7: 24,276,300 C570F probably damaging Het
Zfp943 C T 17: 21,993,376 T481I probably benign Het
Other mutations in Iars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Iars APN 13 49709728 missense probably damaging 1.00
IGL00764:Iars APN 13 49711827 missense probably benign 0.34
IGL01153:Iars APN 13 49711805 missense probably damaging 1.00
IGL01481:Iars APN 13 49728698 missense probably benign 0.00
IGL01596:Iars APN 13 49703176 missense probably benign
IGL01682:Iars APN 13 49709658 missense probably damaging 1.00
IGL01885:Iars APN 13 49691499 missense probably benign 0.25
IGL01907:Iars APN 13 49709655 missense probably damaging 1.00
IGL02023:Iars APN 13 49688249 missense probably damaging 1.00
IGL02121:Iars APN 13 49724696 missense probably benign 0.00
IGL02365:Iars APN 13 49691499 missense probably benign 0.25
IGL02704:Iars APN 13 49721100 missense probably damaging 1.00
IGL02838:Iars APN 13 49690489 missense possibly damaging 0.87
IGL02975:Iars APN 13 49704849 missense probably damaging 1.00
IGL02982:Iars APN 13 49709709 missense probably benign 0.00
IGL03034:Iars APN 13 49690489 missense possibly damaging 0.87
IGL03060:Iars APN 13 49690447 critical splice acceptor site probably null
IGL03156:Iars APN 13 49703179 missense possibly damaging 0.87
IGL03206:Iars APN 13 49693070 missense possibly damaging 0.81
IGL03343:Iars APN 13 49724747 missense probably benign 0.12
gannett_peak UTSW 13 49708421 missense probably damaging 1.00
wind_river UTSW 13 49701895 missense probably damaging 1.00
R0054:Iars UTSW 13 49693135 missense probably damaging 1.00
R0054:Iars UTSW 13 49693135 missense probably damaging 1.00
R0184:Iars UTSW 13 49722212 missense probably benign 0.00
R0200:Iars UTSW 13 49726202 missense possibly damaging 0.62
R0356:Iars UTSW 13 49703233 missense probably benign 0.03
R0383:Iars UTSW 13 49732342 missense probably damaging 0.99
R0657:Iars UTSW 13 49702519 missense probably damaging 1.00
R1005:Iars UTSW 13 49687445 missense possibly damaging 0.94
R1427:Iars UTSW 13 49704269 critical splice acceptor site probably null
R1449:Iars UTSW 13 49733710 missense probably damaging 0.99
R1647:Iars UTSW 13 49723002 missense possibly damaging 0.85
R1648:Iars UTSW 13 49723002 missense possibly damaging 0.85
R1664:Iars UTSW 13 49711775 missense probably damaging 0.98
R1763:Iars UTSW 13 49723077 critical splice donor site probably null
R2192:Iars UTSW 13 49688129 intron probably null
R2203:Iars UTSW 13 49722675 missense probably benign 0.00
R2357:Iars UTSW 13 49688203 missense probably damaging 1.00
R3724:Iars UTSW 13 49687384 critical splice acceptor site probably null
R4785:Iars UTSW 13 49724663 missense probably damaging 0.99
R4934:Iars UTSW 13 49717984 missense probably benign 0.17
R4999:Iars UTSW 13 49709661 missense probably damaging 1.00
R5048:Iars UTSW 13 49688237 missense probably damaging 0.99
R5268:Iars UTSW 13 49690491 missense probably damaging 1.00
R5394:Iars UTSW 13 49722165 missense probably damaging 1.00
R5486:Iars UTSW 13 49709573 splice site probably null
R5960:Iars UTSW 13 49724637 missense possibly damaging 0.68
R5972:Iars UTSW 13 49709632 missense possibly damaging 0.91
R5978:Iars UTSW 13 49722993 missense probably damaging 0.99
R6031:Iars UTSW 13 49705831 missense probably damaging 0.98
R6092:Iars UTSW 13 49708421 missense probably damaging 1.00
R6167:Iars UTSW 13 49722714 missense probably damaging 1.00
R6313:Iars UTSW 13 49708445 missense probably damaging 0.99
R6358:Iars UTSW 13 49727143 missense possibly damaging 0.67
R6385:Iars UTSW 13 49701895 missense probably damaging 1.00
R6403:Iars UTSW 13 49687495 missense probably damaging 1.00
R6575:Iars UTSW 13 49725269 missense probably damaging 1.00
R6675:Iars UTSW 13 49719578 missense probably damaging 0.99
R6957:Iars UTSW 13 49722161 missense probably damaging 1.00
R7207:Iars UTSW 13 49688315 critical splice donor site probably null
R7254:Iars UTSW 13 49723078 critical splice donor site probably null
R7354:Iars UTSW 13 49704320 missense probably benign
R7397:Iars UTSW 13 49728677 missense probably benign 0.00
R7696:Iars UTSW 13 49706738 missense probably damaging 1.00
R7799:Iars UTSW 13 49723018 missense probably damaging 1.00
R7828:Iars UTSW 13 49725272 missense probably benign
Z1088:Iars UTSW 13 49721088 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGGCATCTGCTGATCTGG -3'
(R):5'- GCAGATGTTACTTTAGCTGTATGTGAC -3'

Sequencing Primer
(F):5'- TGCTGATCTGGACACTTGTAATC -3'
(R):5'- AGCTGTATGTGACTGTGTCTTCC -3'
Posted On2017-08-16