Mutagenetix > Incidental Mutations

Incidental Mutation 'R6032:Olfr1289'

486311

Institutional Source

Beutler Lab

Gene Symbol

Olfr1289

Ensembl Gene

ENSMUSG00000061195

Gene Name

olfactory receptor 1289

Synonyms

GA_x6K02T2Q125-72534883-72535821, MOR245-6

MMRRC Submission

044204-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R6032 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

111480819-111484615 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 111483850 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 140 (L140P)

Ref Sequence

ENSEMBL: ENSMUSP00000147119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000104889] [ENSMUST00000120021] [ENSMUST00000207494] [ENSMUST00000214816] [ENSMUST00000217611]

Predicted Effect

probably benign
Transcript: ENSMUST00000104889

SMART Domains

Protein: ENSMUSP00000100485
Gene: ENSMUSG00000044039

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	304	1.3e-43	PFAM
Pfam:7tm_1	41	287	2.5e-20	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120021
AA Change: L168P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000207494
AA Change: L140P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000214816

Predicted Effect

probably benign
Transcript: ENSMUST00000217611

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225425

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.0%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
A2ml1	T	A	6: 128,549,836	K1071*	probably null	Het
Abca13	G	T	11: 9,297,752	V2500F	possibly damaging	Het
Adamdec1	T	C	14: 68,579,184	E85G	probably damaging	Het
Aldh8a1	T	C	10: 21,389,071	V199A	probably benign	Het
Aoc2	G	A	11: 101,325,801	V237M	probably damaging	Het
Aplp2	C	T	9: 31,150,944	R672H	probably damaging	Het
Apob	A	G	12: 7,995,513	N886S	probably benign	Het
Ascc3	C	T	10: 50,842,183	R1991*	probably null	Het
Atp6v1a	T	C	16: 44,106,940	Y328C	probably damaging	Het
Bag4	T	C	8: 25,777,493	Y103C	probably damaging	Het
Crem	C	T	18: 3,267,673	R190Q	probably damaging	Het
Crybg1	A	G	10: 43,956,760	S2000P	probably damaging	Het
Cubn	T	A	2: 13,325,184	T2629S	probably benign	Het
Cyhr1	C	T	15: 76,658,858	R34Q	probably damaging	Het
Cyp3a44	G	T	5: 145,777,946	S465Y	probably damaging	Het
Daam2	A	C	17: 49,486,497	F331V	probably damaging	Het
Dnajc3	T	C	14: 118,968,031	S146P	possibly damaging	Het
Dscam	A	G	16: 96,649,991		probably null	Het
Fam184b	G	A	5: 45,582,896	S316L	probably benign	Het
Fat2	G	C	11: 55,253,934	T4038S	probably damaging	Het
Fbxl19	C	T	7: 127,761,265	R439C	probably damaging	Het
Gm3454	T	A	15: 75,311,599		noncoding transcript	Het
Gpatch3	A	G	4: 133,578,306	E284G	probably benign	Het
Grm1	A	T	10: 10,719,805	I693N	probably damaging	Het
Gsdme	T	A	6: 50,245,954	Q127L	probably damaging	Het
Ifnlr1	A	G	4: 135,705,626	K458E	probably benign	Het
Kcns2	T	C	15: 34,838,934	F148L	probably benign	Het
Lama1	A	G	17: 67,750,643	T571A	probably benign	Het
Loxhd1	G	A	18: 77,381,558	V108M	probably damaging	Het
Mef2c	A	T	13: 83,662,359	T375S	probably benign	Het
Ncor1	A	T	11: 62,373,321	D144E	possibly damaging	Het
Nos3	A	T	5: 24,379,811	T738S	probably benign	Het
Nrxn2	A	T	19: 6,517,132	T1353S	probably damaging	Het
Olfr146	A	G	9: 39,018,965	I192T	probably benign	Het
Olfr1535	G	T	13: 21,555,907	S38R	probably benign	Het
Pfpl	A	G	19: 12,429,383	T333A	probably damaging	Het
Postn	A	T	3: 54,376,716	I565F	possibly damaging	Het
Ppef2	A	G	5: 92,230,524	V604A	probably benign	Het
Pramef12	A	C	4: 144,393,028	I323S	possibly damaging	Het
Prmt1	A	G	7: 44,977,102		probably null	Het
Rel	A	G	11: 23,742,684	S450P	probably benign	Het
Rpap2	A	C	5: 107,597,795	D3A	probably damaging	Het
Shisa9	T	C	16: 11,984,908	F110L	possibly damaging	Het
Slc25a10	A	T	11: 120,494,958		probably null	Het
Slx4	A	T	16: 3,980,157	F1454L	probably damaging	Het
Smc1b	A	T	15: 85,066,229	V1198D	possibly damaging	Het
Supt5	T	C	7: 28,316,175	Y879C	probably damaging	Het
Tbx15	T	C	3: 99,352,517	M568T	probably benign	Het
Tle4	T	C	19: 14,452,108	H698R	possibly damaging	Het
Trappc9	T	C	15: 72,925,530	N803D	probably benign	Het
Trim10	A	T	17: 36,871,714	R157S	possibly damaging	Het
Wsb1	T	C	11: 79,240,199		probably benign	Het
Zfp106	T	C	2: 120,535,393	S178G	probably benign	Het

Other mutations in Olfr1289

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Olfr1289	APN	2	111484101	missense	probably damaging	1.00
IGL01682:Olfr1289	APN	2	111483843	missense	probably damaging	1.00
IGL02028:Olfr1289	APN	2	111483471	missense	probably benign	0.01
IGL02731:Olfr1289	APN	2	111483528	missense	probably benign	0.00
IGL03035:Olfr1289	APN	2	111483823	missense	probably benign	0.04
R1214:Olfr1289	UTSW	2	111483892	missense	probably damaging	1.00
R1471:Olfr1289	UTSW	2	111484006	missense	probably damaging	1.00
R1714:Olfr1289	UTSW	2	111483663	missense	probably damaging	1.00
R2088:Olfr1289	UTSW	2	111484278	missense	probably damaging	1.00
R2136:Olfr1289	UTSW	2	111483616	missense	probably damaging	1.00
R2141:Olfr1289	UTSW	2	111483630	missense	probably benign	0.23
R3945:Olfr1289	UTSW	2	111483687	nonsense	probably null
R4276:Olfr1289	UTSW	2	111483504	missense	probably damaging	1.00
R4562:Olfr1289	UTSW	2	111483564	missense	probably benign	0.00
R4896:Olfr1289	UTSW	2	111483660	missense	possibly damaging	0.82
R4946:Olfr1289	UTSW	2	111483966	missense	possibly damaging	0.93
R5004:Olfr1289	UTSW	2	111483660	missense	possibly damaging	0.82
R5686:Olfr1289	UTSW	2	111484143	missense	probably damaging	1.00
R6032:Olfr1289	UTSW	2	111483850	missense	probably damaging	1.00
R6960:Olfr1289	UTSW	2	111483726	missense	possibly damaging	0.70
R7293:Olfr1289	UTSW	2	111483354	splice site	probably null
R7642:Olfr1289	UTSW	2	111483478	missense	probably damaging	0.96
R8429:Olfr1289	UTSW	2	111483495	missense	possibly damaging	0.55
R8447:Olfr1289	UTSW	2	111483756	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCATCTCTGTTAAGGGCTGC -3'
(R):5'- GCAGTCAGTGTAGACAGAGC -3'

Sequencing Primer
(F):5'- GGGCTGCTTTACACAAATATTCC -3'
(R):5'- GTAGACAGAGCCTTAGATGACCTATC -3'

Posted On

2017-08-16