Incidental Mutation 'R6032:Tbx15'
ID 486314
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 044204-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R6032 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99259833 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 568 (M568T)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462]
AlphaFold O70306
Predicted Effect probably benign
Transcript: ENSMUST00000029462
AA Change: M568T

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: M568T

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
A2ml1 T A 6: 128,526,799 (GRCm39) K1071* probably null Het
Abca13 G T 11: 9,247,752 (GRCm39) V2500F possibly damaging Het
Adamdec1 T C 14: 68,816,633 (GRCm39) E85G probably damaging Het
Aldh8a1 T C 10: 21,264,970 (GRCm39) V199A probably benign Het
Aoc2 G A 11: 101,216,627 (GRCm39) V237M probably damaging Het
Aplp2 C T 9: 31,062,240 (GRCm39) R672H probably damaging Het
Apob A G 12: 8,045,513 (GRCm39) N886S probably benign Het
Ascc3 C T 10: 50,718,279 (GRCm39) R1991* probably null Het
Atp6v1a T C 16: 43,927,303 (GRCm39) Y328C probably damaging Het
Bag4 T C 8: 26,267,521 (GRCm39) Y103C probably damaging Het
Crem C T 18: 3,267,673 (GRCm39) R190Q probably damaging Het
Crybg1 A G 10: 43,832,756 (GRCm39) S2000P probably damaging Het
Cubn T A 2: 13,329,995 (GRCm39) T2629S probably benign Het
Cyp3a44 G T 5: 145,714,756 (GRCm39) S465Y probably damaging Het
Daam2 A C 17: 49,793,525 (GRCm39) F331V probably damaging Het
Dnajc3 T C 14: 119,205,443 (GRCm39) S146P possibly damaging Het
Dscam A G 16: 96,451,191 (GRCm39) probably null Het
Fam184b G A 5: 45,740,238 (GRCm39) S316L probably benign Het
Fat2 G C 11: 55,144,760 (GRCm39) T4038S probably damaging Het
Fbxl19 C T 7: 127,360,437 (GRCm39) R439C probably damaging Het
Gm3454 T A 15: 75,183,448 (GRCm39) noncoding transcript Het
Gpatch3 A G 4: 133,305,617 (GRCm39) E284G probably benign Het
Grm1 A T 10: 10,595,549 (GRCm39) I693N probably damaging Het
Gsdme T A 6: 50,222,934 (GRCm39) Q127L probably damaging Het
Ifnlr1 A G 4: 135,432,937 (GRCm39) K458E probably benign Het
Kcns2 T C 15: 34,839,080 (GRCm39) F148L probably benign Het
Lama1 A G 17: 68,057,638 (GRCm39) T571A probably benign Het
Loxhd1 G A 18: 77,469,254 (GRCm39) V108M probably damaging Het
Mef2c A T 13: 83,810,478 (GRCm39) T375S probably benign Het
Ncor1 A T 11: 62,264,147 (GRCm39) D144E possibly damaging Het
Nos3 A T 5: 24,584,809 (GRCm39) T738S probably benign Het
Nrxn2 A T 19: 6,567,162 (GRCm39) T1353S probably damaging Het
Or2b7 G T 13: 21,740,077 (GRCm39) S38R probably benign Het
Or4f4b T C 2: 111,314,195 (GRCm39) L140P probably damaging Het
Or8g17 A G 9: 38,930,261 (GRCm39) I192T probably benign Het
Pfpl A G 19: 12,406,747 (GRCm39) T333A probably damaging Het
Postn A T 3: 54,284,137 (GRCm39) I565F possibly damaging Het
Ppef2 A G 5: 92,378,383 (GRCm39) V604A probably benign Het
Pramel13 A C 4: 144,119,598 (GRCm39) I323S possibly damaging Het
Prmt1 A G 7: 44,626,526 (GRCm39) probably null Het
Rel A G 11: 23,692,684 (GRCm39) S450P probably benign Het
Rpap2 A C 5: 107,745,661 (GRCm39) D3A probably damaging Het
Shisa9 T C 16: 11,802,772 (GRCm39) F110L possibly damaging Het
Slc25a10 A T 11: 120,385,784 (GRCm39) probably null Het
Slx4 A T 16: 3,798,021 (GRCm39) F1454L probably damaging Het
Smc1b A T 15: 84,950,430 (GRCm39) V1198D possibly damaging Het
Supt5 T C 7: 28,015,600 (GRCm39) Y879C probably damaging Het
Tle4 T C 19: 14,429,472 (GRCm39) H698R possibly damaging Het
Trappc9 T C 15: 72,797,379 (GRCm39) N803D probably benign Het
Trim10 A T 17: 37,182,606 (GRCm39) R157S possibly damaging Het
Wsb1 T C 11: 79,131,025 (GRCm39) probably benign Het
Zfp106 T C 2: 120,365,874 (GRCm39) S178G probably benign Het
Zftraf1 C T 15: 76,543,058 (GRCm39) R34Q probably damaging Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACACATGTTTGGTGGCAG -3'
(R):5'- AGGATGATCCACCCACAGAGATTC -3'

Sequencing Primer
(F):5'- TGCAGCAGAGCTCCTATAATG -3'
(R):5'- CAGAGATTCTGGAGTCTTGGCC -3'
Posted On 2017-08-16