Mutagenetix > Incidental Mutation

Incidental Mutation 'R6032:Tbx15'

486314

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

044204-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R6032 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99352517 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 568 (M568T)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462]

AlphaFold

O70306

Predicted Effect

probably benign
Transcript: ENSMUST00000029462
AA Change: M568T

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: M568T

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Meta Mutation Damage Score

0.0611

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.0%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
A2ml1	T	A	6: 128,549,836	K1071*	probably null	Het
Abca13	G	T	11: 9,297,752	V2500F	possibly damaging	Het
Adamdec1	T	C	14: 68,579,184	E85G	probably damaging	Het
Aldh8a1	T	C	10: 21,389,071	V199A	probably benign	Het
Aoc2	G	A	11: 101,325,801	V237M	probably damaging	Het
Aplp2	C	T	9: 31,150,944	R672H	probably damaging	Het
Apob	A	G	12: 7,995,513	N886S	probably benign	Het
Ascc3	C	T	10: 50,842,183	R1991*	probably null	Het
Atp6v1a	T	C	16: 44,106,940	Y328C	probably damaging	Het
Bag4	T	C	8: 25,777,493	Y103C	probably damaging	Het
Crem	C	T	18: 3,267,673	R190Q	probably damaging	Het
Crybg1	A	G	10: 43,956,760	S2000P	probably damaging	Het
Cubn	T	A	2: 13,325,184	T2629S	probably benign	Het
Cyhr1	C	T	15: 76,658,858	R34Q	probably damaging	Het
Cyp3a44	G	T	5: 145,777,946	S465Y	probably damaging	Het
Daam2	A	C	17: 49,486,497	F331V	probably damaging	Het
Dnajc3	T	C	14: 118,968,031	S146P	possibly damaging	Het
Dscam	A	G	16: 96,649,991		probably null	Het
Fam184b	G	A	5: 45,582,896	S316L	probably benign	Het
Fat2	G	C	11: 55,253,934	T4038S	probably damaging	Het
Fbxl19	C	T	7: 127,761,265	R439C	probably damaging	Het
Gm3454	T	A	15: 75,311,599		noncoding transcript	Het
Gpatch3	A	G	4: 133,578,306	E284G	probably benign	Het
Grm1	A	T	10: 10,719,805	I693N	probably damaging	Het
Gsdme	T	A	6: 50,245,954	Q127L	probably damaging	Het
Ifnlr1	A	G	4: 135,705,626	K458E	probably benign	Het
Kcns2	T	C	15: 34,838,934	F148L	probably benign	Het
Lama1	A	G	17: 67,750,643	T571A	probably benign	Het
Loxhd1	G	A	18: 77,381,558	V108M	probably damaging	Het
Mef2c	A	T	13: 83,662,359	T375S	probably benign	Het
Ncor1	A	T	11: 62,373,321	D144E	possibly damaging	Het
Nos3	A	T	5: 24,379,811	T738S	probably benign	Het
Nrxn2	A	T	19: 6,517,132	T1353S	probably damaging	Het
Olfr1289	T	C	2: 111,483,850	L140P	probably damaging	Het
Olfr146	A	G	9: 39,018,965	I192T	probably benign	Het
Olfr1535	G	T	13: 21,555,907	S38R	probably benign	Het
Pfpl	A	G	19: 12,429,383	T333A	probably damaging	Het
Postn	A	T	3: 54,376,716	I565F	possibly damaging	Het
Ppef2	A	G	5: 92,230,524	V604A	probably benign	Het
Pramef12	A	C	4: 144,393,028	I323S	possibly damaging	Het
Prmt1	A	G	7: 44,977,102		probably null	Het
Rel	A	G	11: 23,742,684	S450P	probably benign	Het
Rpap2	A	C	5: 107,597,795	D3A	probably damaging	Het
Shisa9	T	C	16: 11,984,908	F110L	possibly damaging	Het
Slc25a10	A	T	11: 120,494,958		probably null	Het
Slx4	A	T	16: 3,980,157	F1454L	probably damaging	Het
Smc1b	A	T	15: 85,066,229	V1198D	possibly damaging	Het
Supt5	T	C	7: 28,316,175	Y879C	probably damaging	Het
Tle4	T	C	19: 14,452,108	H698R	possibly damaging	Het
Trappc9	T	C	15: 72,925,530	N803D	probably benign	Het
Trim10	A	T	17: 36,871,714	R157S	possibly damaging	Het
Wsb1	T	C	11: 79,240,199		probably benign	Het
Zfp106	T	C	2: 120,535,393	S178G	probably benign	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACACATGTTTGGTGGCAG -3'
(R):5'- AGGATGATCCACCCACAGAGATTC -3'

Sequencing Primer
(F):5'- TGCAGCAGAGCTCCTATAATG -3'
(R):5'- CAGAGATTCTGGAGTCTTGGCC -3'

Posted On

2017-08-16