Incidental Mutation 'R6032:Fam184b'
ID486319
Institutional Source Beutler Lab
Gene Symbol Fam184b
Ensembl Gene ENSMUSG00000015879
Gene Namefamily with sequence similarity 184, member B
Synonyms9630031F12Rik
MMRRC Submission 044204-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6032 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location45529705-45639614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45582896 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 316 (S316L)
Ref Sequence ENSEMBL: ENSMUSP00000016023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016023]
Predicted Effect probably benign
Transcript: ENSMUST00000016023
AA Change: S316L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000016023
Gene: ENSMUSG00000015879
AA Change: S316L

DomainStartEndE-ValueType
Pfam:FAM184 50 248 7.7e-28 PFAM
coiled coil region 284 337 N/A INTRINSIC
coiled coil region 387 495 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
coiled coil region 575 620 N/A INTRINSIC
coiled coil region 686 775 N/A INTRINSIC
Meta Mutation Damage Score 0.0738 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2ml1 T A 6: 128,549,836 K1071* probably null Het
Abca13 G T 11: 9,297,752 V2500F possibly damaging Het
Adamdec1 T C 14: 68,579,184 E85G probably damaging Het
Aldh8a1 T C 10: 21,389,071 V199A probably benign Het
Aoc2 G A 11: 101,325,801 V237M probably damaging Het
Aplp2 C T 9: 31,150,944 R672H probably damaging Het
Apob A G 12: 7,995,513 N886S probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Atp6v1a T C 16: 44,106,940 Y328C probably damaging Het
Bag4 T C 8: 25,777,493 Y103C probably damaging Het
Crem C T 18: 3,267,673 R190Q probably damaging Het
Crybg1 A G 10: 43,956,760 S2000P probably damaging Het
Cubn T A 2: 13,325,184 T2629S probably benign Het
Cyhr1 C T 15: 76,658,858 R34Q probably damaging Het
Cyp3a44 G T 5: 145,777,946 S465Y probably damaging Het
Daam2 A C 17: 49,486,497 F331V probably damaging Het
Dnajc3 T C 14: 118,968,031 S146P possibly damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fat2 G C 11: 55,253,934 T4038S probably damaging Het
Fbxl19 C T 7: 127,761,265 R439C probably damaging Het
Gm3454 T A 15: 75,311,599 noncoding transcript Het
Gpatch3 A G 4: 133,578,306 E284G probably benign Het
Grm1 A T 10: 10,719,805 I693N probably damaging Het
Gsdme T A 6: 50,245,954 Q127L probably damaging Het
Ifnlr1 A G 4: 135,705,626 K458E probably benign Het
Kcns2 T C 15: 34,838,934 F148L probably benign Het
Lama1 A G 17: 67,750,643 T571A probably benign Het
Loxhd1 G A 18: 77,381,558 V108M probably damaging Het
Mef2c A T 13: 83,662,359 T375S probably benign Het
Ncor1 A T 11: 62,373,321 D144E possibly damaging Het
Nos3 A T 5: 24,379,811 T738S probably benign Het
Nrxn2 A T 19: 6,517,132 T1353S probably damaging Het
Olfr1289 T C 2: 111,483,850 L140P probably damaging Het
Olfr146 A G 9: 39,018,965 I192T probably benign Het
Olfr1535 G T 13: 21,555,907 S38R probably benign Het
Pfpl A G 19: 12,429,383 T333A probably damaging Het
Postn A T 3: 54,376,716 I565F possibly damaging Het
Ppef2 A G 5: 92,230,524 V604A probably benign Het
Pramef12 A C 4: 144,393,028 I323S possibly damaging Het
Prmt1 A G 7: 44,977,102 probably null Het
Rel A G 11: 23,742,684 S450P probably benign Het
Rpap2 A C 5: 107,597,795 D3A probably damaging Het
Shisa9 T C 16: 11,984,908 F110L possibly damaging Het
Slc25a10 A T 11: 120,494,958 probably null Het
Slx4 A T 16: 3,980,157 F1454L probably damaging Het
Smc1b A T 15: 85,066,229 V1198D possibly damaging Het
Supt5 T C 7: 28,316,175 Y879C probably damaging Het
Tbx15 T C 3: 99,352,517 M568T probably benign Het
Tle4 T C 19: 14,452,108 H698R possibly damaging Het
Trappc9 T C 15: 72,925,530 N803D probably benign Het
Trim10 A T 17: 36,871,714 R157S possibly damaging Het
Wsb1 T C 11: 79,240,199 probably benign Het
Zfp106 T C 2: 120,535,393 S178G probably benign Het
Other mutations in Fam184b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Fam184b APN 5 45539749 missense probably benign 0.17
IGL00781:Fam184b APN 5 45555192 splice site probably null
IGL01636:Fam184b APN 5 45584295 missense probably benign 0.00
IGL02008:Fam184b APN 5 45532823 missense possibly damaging 0.75
IGL02123:Fam184b APN 5 45639151 missense possibly damaging 0.92
IGL02177:Fam184b APN 5 45532815 nonsense probably null
IGL02192:Fam184b APN 5 45537720 missense probably benign 0.00
IGL02478:Fam184b APN 5 45537697 missense probably damaging 0.99
IGL03368:Fam184b APN 5 45531824 missense possibly damaging 0.91
R0003:Fam184b UTSW 5 45555194 splice site probably benign
R0129:Fam184b UTSW 5 45532778 missense probably damaging 1.00
R0420:Fam184b UTSW 5 45584512 missense probably damaging 1.00
R0647:Fam184b UTSW 5 45584590 missense probably benign
R1215:Fam184b UTSW 5 45584178 missense probably damaging 1.00
R1374:Fam184b UTSW 5 45555143 missense probably benign
R1466:Fam184b UTSW 5 45580509 splice site probably benign
R1773:Fam184b UTSW 5 45584334 missense possibly damaging 0.60
R1865:Fam184b UTSW 5 45531889 missense possibly damaging 0.91
R3615:Fam184b UTSW 5 45582815 missense possibly damaging 0.56
R3616:Fam184b UTSW 5 45582815 missense possibly damaging 0.56
R4180:Fam184b UTSW 5 45539764 missense probably benign 0.00
R4375:Fam184b UTSW 5 45542343 missense probably benign
R4674:Fam184b UTSW 5 45582888 nonsense probably null
R4942:Fam184b UTSW 5 45573307 missense probably damaging 0.97
R5021:Fam184b UTSW 5 45573262 missense probably benign 0.01
R5450:Fam184b UTSW 5 45539801 missense probably benign
R5731:Fam184b UTSW 5 45553129 missense probably benign 0.00
R5858:Fam184b UTSW 5 45639119 missense probably damaging 0.99
R6032:Fam184b UTSW 5 45582896 missense probably benign 0.01
R6060:Fam184b UTSW 5 45553147 missense probably damaging 0.99
R6088:Fam184b UTSW 5 45584012 missense probably damaging 1.00
R6416:Fam184b UTSW 5 45537653 missense probably benign 0.04
R6932:Fam184b UTSW 5 45532901 splice site probably null
R6956:Fam184b UTSW 5 45530757 missense probably damaging 0.97
R6965:Fam184b UTSW 5 45555135 missense probably benign
R7229:Fam184b UTSW 5 45584175 missense probably damaging 1.00
R7303:Fam184b UTSW 5 45542226 critical splice donor site probably null
R7429:Fam184b UTSW 5 45540888 missense probably benign
R7522:Fam184b UTSW 5 45530751 missense probably damaging 1.00
R7541:Fam184b UTSW 5 45542232 missense probably damaging 0.99
R7942:Fam184b UTSW 5 45584253 missense probably benign 0.16
R8172:Fam184b UTSW 5 45584367 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTAGCCAATCAGATGCAATGG -3'
(R):5'- AAGGTGACTGCTGATCCTCC -3'

Sequencing Primer
(F):5'- ATCAGATGCAATGGTCCCG -3'
(R):5'- CCCTCCCAGCTGCTATAATTCTAGAG -3'
Posted On2017-08-16