Incidental Mutation 'R6032:Adamdec1'
ID 486345
Institutional Source Beutler Lab
Gene Symbol Adamdec1
Ensembl Gene ENSMUSG00000022057
Gene Name ADAM-like, decysin 1
Synonyms 2210414L24Rik, Dcsn
MMRRC Submission 044204-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R6032 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 68563380-68582095 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 68579184 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 85 (E85G)
Ref Sequence ENSEMBL: ENSMUSP00000022641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022641]
AlphaFold Q9R0X2
Predicted Effect probably damaging
Transcript: ENSMUST00000022641
AA Change: E85G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022641
Gene: ENSMUSG00000022057
AA Change: E85G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 37 175 3.9e-29 PFAM
Pfam:Reprolysin_5 215 389 9.8e-17 PFAM
Pfam:Reprolysin_4 216 407 7.3e-12 PFAM
Pfam:Reprolysin 217 411 1.5e-57 PFAM
Pfam:Reprolysin_3 242 360 1e-11 PFAM
DISIN 427 465 1.12e-3 SMART
Meta Mutation Damage Score 0.3036 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This encoded protein is thought to be a secreted protein belonging to the disintegrin metalloproteinase family. Its expression is upregulated during dendritic cells maturation. This protein may play an important role in dendritic cell function and their interactions with germinal center T cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2ml1 T A 6: 128,549,836 K1071* probably null Het
Abca13 G T 11: 9,297,752 V2500F possibly damaging Het
Aldh8a1 T C 10: 21,389,071 V199A probably benign Het
Aoc2 G A 11: 101,325,801 V237M probably damaging Het
Aplp2 C T 9: 31,150,944 R672H probably damaging Het
Apob A G 12: 7,995,513 N886S probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Atp6v1a T C 16: 44,106,940 Y328C probably damaging Het
Bag4 T C 8: 25,777,493 Y103C probably damaging Het
Crem C T 18: 3,267,673 R190Q probably damaging Het
Crybg1 A G 10: 43,956,760 S2000P probably damaging Het
Cubn T A 2: 13,325,184 T2629S probably benign Het
Cyhr1 C T 15: 76,658,858 R34Q probably damaging Het
Cyp3a44 G T 5: 145,777,946 S465Y probably damaging Het
Daam2 A C 17: 49,486,497 F331V probably damaging Het
Dnajc3 T C 14: 118,968,031 S146P possibly damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fam184b G A 5: 45,582,896 S316L probably benign Het
Fat2 G C 11: 55,253,934 T4038S probably damaging Het
Fbxl19 C T 7: 127,761,265 R439C probably damaging Het
Gm3454 T A 15: 75,311,599 noncoding transcript Het
Gpatch3 A G 4: 133,578,306 E284G probably benign Het
Grm1 A T 10: 10,719,805 I693N probably damaging Het
Gsdme T A 6: 50,245,954 Q127L probably damaging Het
Ifnlr1 A G 4: 135,705,626 K458E probably benign Het
Kcns2 T C 15: 34,838,934 F148L probably benign Het
Lama1 A G 17: 67,750,643 T571A probably benign Het
Loxhd1 G A 18: 77,381,558 V108M probably damaging Het
Mef2c A T 13: 83,662,359 T375S probably benign Het
Ncor1 A T 11: 62,373,321 D144E possibly damaging Het
Nos3 A T 5: 24,379,811 T738S probably benign Het
Nrxn2 A T 19: 6,517,132 T1353S probably damaging Het
Olfr1289 T C 2: 111,483,850 L140P probably damaging Het
Olfr146 A G 9: 39,018,965 I192T probably benign Het
Olfr1535 G T 13: 21,555,907 S38R probably benign Het
Pfpl A G 19: 12,429,383 T333A probably damaging Het
Postn A T 3: 54,376,716 I565F possibly damaging Het
Ppef2 A G 5: 92,230,524 V604A probably benign Het
Pramef12 A C 4: 144,393,028 I323S possibly damaging Het
Prmt1 A G 7: 44,977,102 probably null Het
Rel A G 11: 23,742,684 S450P probably benign Het
Rpap2 A C 5: 107,597,795 D3A probably damaging Het
Shisa9 T C 16: 11,984,908 F110L possibly damaging Het
Slc25a10 A T 11: 120,494,958 probably null Het
Slx4 A T 16: 3,980,157 F1454L probably damaging Het
Smc1b A T 15: 85,066,229 V1198D possibly damaging Het
Supt5 T C 7: 28,316,175 Y879C probably damaging Het
Tbx15 T C 3: 99,352,517 M568T probably benign Het
Tle4 T C 19: 14,452,108 H698R possibly damaging Het
Trappc9 T C 15: 72,925,530 N803D probably benign Het
Trim10 A T 17: 36,871,714 R157S possibly damaging Het
Wsb1 T C 11: 79,240,199 probably benign Het
Zfp106 T C 2: 120,535,393 S178G probably benign Het
Other mutations in Adamdec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Adamdec1 APN 14 68573107 missense probably damaging 1.00
IGL02026:Adamdec1 APN 14 68571802 missense possibly damaging 0.81
IGL02068:Adamdec1 APN 14 68577109 missense probably benign 0.21
IGL02416:Adamdec1 APN 14 68572833 missense probably null 0.99
IGL02739:Adamdec1 APN 14 68570156 nonsense probably null
IGL03078:Adamdec1 APN 14 68568850 missense possibly damaging 0.53
IGL03115:Adamdec1 APN 14 68571353 missense probably damaging 1.00
R0201:Adamdec1 UTSW 14 68581957 critical splice donor site probably null
R0243:Adamdec1 UTSW 14 68581958 critical splice donor site probably null
R0244:Adamdec1 UTSW 14 68568723 nonsense probably null
R0416:Adamdec1 UTSW 14 68568712 missense possibly damaging 0.79
R1373:Adamdec1 UTSW 14 68570951 missense probably damaging 1.00
R1856:Adamdec1 UTSW 14 68570948 missense probably damaging 1.00
R2570:Adamdec1 UTSW 14 68579208 missense probably damaging 0.98
R3684:Adamdec1 UTSW 14 68581998 missense probably benign 0.04
R3755:Adamdec1 UTSW 14 68577138 missense probably damaging 1.00
R4450:Adamdec1 UTSW 14 68573119 missense probably benign 0.00
R4661:Adamdec1 UTSW 14 68570113 missense probably damaging 1.00
R4672:Adamdec1 UTSW 14 68577904 nonsense probably null
R4673:Adamdec1 UTSW 14 68577904 nonsense probably null
R4902:Adamdec1 UTSW 14 68571766 missense probably damaging 0.99
R5017:Adamdec1 UTSW 14 68573245 missense probably benign 0.01
R5018:Adamdec1 UTSW 14 68571779 missense probably damaging 1.00
R5141:Adamdec1 UTSW 14 68573128 missense probably benign 0.00
R5329:Adamdec1 UTSW 14 68570163 missense probably damaging 1.00
R5395:Adamdec1 UTSW 14 68570903 missense probably benign 0.04
R5864:Adamdec1 UTSW 14 68570102 missense probably damaging 1.00
R6032:Adamdec1 UTSW 14 68579184 missense probably damaging 1.00
R6114:Adamdec1 UTSW 14 68571803 missense probably benign 0.00
R6633:Adamdec1 UTSW 14 68573152 missense probably benign 0.03
R7243:Adamdec1 UTSW 14 68571754 missense probably benign 0.06
R7580:Adamdec1 UTSW 14 68565531 missense probably benign 0.00
R8388:Adamdec1 UTSW 14 68573235 nonsense probably null
R9133:Adamdec1 UTSW 14 68577098 nonsense probably null
X0025:Adamdec1 UTSW 14 68570158 missense probably damaging 1.00
X0050:Adamdec1 UTSW 14 68570158 missense probably damaging 1.00
X0062:Adamdec1 UTSW 14 68573252 missense probably benign 0.12
Z1177:Adamdec1 UTSW 14 68580643 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACTTGTCTTGGCATCGGAG -3'
(R):5'- GCCTCATTAATCTGTGTGGTTTTCAAG -3'

Sequencing Primer
(F):5'- TGCCATCTGGAACTGTAAGC -3'
(R):5'- TGTGAATTCCATATGAATGTGCC -3'
Posted On 2017-08-16