Incidental Mutation 'R6032:Shisa9'
ID486353
Institutional Source Beutler Lab
Gene Symbol Shisa9
Ensembl Gene ENSMUSG00000022494
Gene Nameshisa family member 9
SynonymsCKAMP44, 2700045P11Rik
MMRRC Submission 044204-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6032 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location11984113-12270902 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11984908 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 110 (F110L)
Ref Sequence ENSEMBL: ENSMUSP00000023138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023138] [ENSMUST00000170672]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023138
AA Change: F110L

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023138
Gene: ENSMUSG00000022494
AA Change: F110L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 28 61 N/A INTRINSIC
Pfam:Shisa 70 254 7.9e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170672
AA Change: F110L

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132646
Gene: ENSMUSG00000022494
AA Change: F110L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 28 61 N/A INTRINSIC
Pfam:Shisa 71 260 2.1e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232469
Meta Mutation Damage Score 0.0623 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced AMPA-mediated synaptic currents in retinogeniculate and corticogeniculate synapses, enhanced paired-pulse facilitation in retinogeniculate synapses and decreased synaptic depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2ml1 T A 6: 128,549,836 K1071* probably null Het
Abca13 G T 11: 9,297,752 V2500F possibly damaging Het
Adamdec1 T C 14: 68,579,184 E85G probably damaging Het
Aldh8a1 T C 10: 21,389,071 V199A probably benign Het
Aoc2 G A 11: 101,325,801 V237M probably damaging Het
Aplp2 C T 9: 31,150,944 R672H probably damaging Het
Apob A G 12: 7,995,513 N886S probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Atp6v1a T C 16: 44,106,940 Y328C probably damaging Het
Bag4 T C 8: 25,777,493 Y103C probably damaging Het
Crem C T 18: 3,267,673 R190Q probably damaging Het
Crybg1 A G 10: 43,956,760 S2000P probably damaging Het
Cubn T A 2: 13,325,184 T2629S probably benign Het
Cyhr1 C T 15: 76,658,858 R34Q probably damaging Het
Cyp3a44 G T 5: 145,777,946 S465Y probably damaging Het
Daam2 A C 17: 49,486,497 F331V probably damaging Het
Dnajc3 T C 14: 118,968,031 S146P possibly damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fam184b G A 5: 45,582,896 S316L probably benign Het
Fat2 G C 11: 55,253,934 T4038S probably damaging Het
Fbxl19 C T 7: 127,761,265 R439C probably damaging Het
Gm3454 T A 15: 75,311,599 noncoding transcript Het
Gpatch3 A G 4: 133,578,306 E284G probably benign Het
Grm1 A T 10: 10,719,805 I693N probably damaging Het
Gsdme T A 6: 50,245,954 Q127L probably damaging Het
Ifnlr1 A G 4: 135,705,626 K458E probably benign Het
Kcns2 T C 15: 34,838,934 F148L probably benign Het
Lama1 A G 17: 67,750,643 T571A probably benign Het
Loxhd1 G A 18: 77,381,558 V108M probably damaging Het
Mef2c A T 13: 83,662,359 T375S probably benign Het
Ncor1 A T 11: 62,373,321 D144E possibly damaging Het
Nos3 A T 5: 24,379,811 T738S probably benign Het
Nrxn2 A T 19: 6,517,132 T1353S probably damaging Het
Olfr1289 T C 2: 111,483,850 L140P probably damaging Het
Olfr146 A G 9: 39,018,965 I192T probably benign Het
Olfr1535 G T 13: 21,555,907 S38R probably benign Het
Pfpl A G 19: 12,429,383 T333A probably damaging Het
Postn A T 3: 54,376,716 I565F possibly damaging Het
Ppef2 A G 5: 92,230,524 V604A probably benign Het
Pramef12 A C 4: 144,393,028 I323S possibly damaging Het
Prmt1 A G 7: 44,977,102 probably null Het
Rel A G 11: 23,742,684 S450P probably benign Het
Rpap2 A C 5: 107,597,795 D3A probably damaging Het
Slc25a10 A T 11: 120,494,958 probably null Het
Slx4 A T 16: 3,980,157 F1454L probably damaging Het
Smc1b A T 15: 85,066,229 V1198D possibly damaging Het
Supt5 T C 7: 28,316,175 Y879C probably damaging Het
Tbx15 T C 3: 99,352,517 M568T probably benign Het
Tle4 T C 19: 14,452,108 H698R possibly damaging Het
Trappc9 T C 15: 72,925,530 N803D probably benign Het
Trim10 A T 17: 36,871,714 R157S possibly damaging Het
Wsb1 T C 11: 79,240,199 probably benign Het
Zfp106 T C 2: 120,535,393 S178G probably benign Het
Other mutations in Shisa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Shisa9 APN 16 12244658 missense probably benign 0.04
IGL02011:Shisa9 APN 16 12244638 missense possibly damaging 0.87
IGL02884:Shisa9 APN 16 11997043 splice site probably benign
PIT4508001:Shisa9 UTSW 16 12267480 missense probably benign 0.00
R0194:Shisa9 UTSW 16 11984954 missense probably damaging 1.00
R0309:Shisa9 UTSW 16 11997123 missense probably damaging 1.00
R0588:Shisa9 UTSW 16 12267774 missense probably damaging 0.99
R1469:Shisa9 UTSW 16 11985071 missense probably damaging 1.00
R1469:Shisa9 UTSW 16 11985071 missense probably damaging 1.00
R1781:Shisa9 UTSW 16 12267657 missense probably benign 0.00
R1818:Shisa9 UTSW 16 12267562 missense probably damaging 0.96
R1943:Shisa9 UTSW 16 12267756 missense probably benign 0.06
R2263:Shisa9 UTSW 16 11984767 missense possibly damaging 0.53
R3742:Shisa9 UTSW 16 12267664 missense probably damaging 1.00
R5068:Shisa9 UTSW 16 12267548 missense possibly damaging 0.48
R5977:Shisa9 UTSW 16 12267428 missense probably benign 0.01
R6032:Shisa9 UTSW 16 11984908 missense possibly damaging 0.76
R6487:Shisa9 UTSW 16 12244611 missense probably benign 0.01
R6773:Shisa9 UTSW 16 11985028 missense probably damaging 1.00
R8341:Shisa9 UTSW 16 11997151 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- TTCCTCACCGAGCTGTGTG -3'
(R):5'- CTTGGTGAAGATGCCCACCAG -3'

Sequencing Primer
(F):5'- TACTGCTGCTCACAGGGG -3'
(R):5'- TGCCCACCAGCACCATG -3'
Posted On2017-08-16