Incidental Mutation 'R6032:Crem'
ID486359
Institutional Source Beutler Lab
Gene Symbol Crem
Ensembl Gene ENSMUSG00000063889
Gene NamecAMP responsive element modulator
SynonymsICER
MMRRC Submission 044204-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R6032 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location3266048-3337748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3267673 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 190 (R190Q)
Ref Sequence ENSEMBL: ENSMUSP00000122241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025069] [ENSMUST00000049942] [ENSMUST00000082141] [ENSMUST00000122958] [ENSMUST00000123672] [ENSMUST00000124747] [ENSMUST00000126578] [ENSMUST00000129435] [ENSMUST00000130455] [ENSMUST00000130599] [ENSMUST00000131899] [ENSMUST00000134027] [ENSMUST00000136961] [ENSMUST00000137568] [ENSMUST00000139537] [ENSMUST00000140332] [ENSMUST00000144496] [ENSMUST00000146265] [ENSMUST00000147138] [ENSMUST00000148305] [ENSMUST00000150235] [ENSMUST00000151084] [ENSMUST00000151311] [ENSMUST00000152108] [ENSMUST00000152900] [ENSMUST00000154135] [ENSMUST00000154470] [ENSMUST00000154705] [ENSMUST00000154715] [ENSMUST00000156234] [ENSMUST00000165086]
Predicted Effect probably benign
Transcript: ENSMUST00000025069
SMART Domains Protein: ENSMUSP00000025069
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 3.1e-20 PFAM
BRLZ 285 343 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049942
SMART Domains Protein: ENSMUSP00000061925
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
BRLZ 59 117 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000082141
SMART Domains Protein: ENSMUSP00000080780
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
Pfam:pKID 63 104 2.6e-20 PFAM
BRLZ 248 306 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122958
AA Change: R277Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121118
Gene: ENSMUSG00000063889
AA Change: R277Q

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:pKID 59 100 7.8e-21 PFAM
BRLZ 244 301 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123672
AA Change: R190Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120557
Gene: ENSMUSG00000063889
AA Change: R190Q

DomainStartEndE-ValueType
Pfam:pKID 47 88 1.5e-20 PFAM
BRLZ 157 214 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124747
SMART Domains Protein: ENSMUSP00000121352
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
BRLZ 42 100 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126578
SMART Domains Protein: ENSMUSP00000114780
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:pKID 59 100 7.8e-21 PFAM
BRLZ 244 302 3.8e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000127601
AA Change: R303Q
SMART Domains Protein: ENSMUSP00000118649
Gene: ENSMUSG00000063889
AA Change: R303Q

DomainStartEndE-ValueType
low complexity region 63 74 N/A INTRINSIC
Pfam:pKID 98 139 3.1e-21 PFAM
BRLZ 271 328 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129435
AA Change: R216Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117438
Gene: ENSMUSG00000063889
AA Change: R216Q

DomainStartEndE-ValueType
Pfam:pKID 10 51 5.6e-21 PFAM
BRLZ 183 240 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130455
SMART Domains Protein: ENSMUSP00000121541
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
low complexity region 67 78 N/A INTRINSIC
Pfam:pKID 102 143 2.8e-20 PFAM
BRLZ 275 333 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130599
AA Change: R202Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115471
Gene: ENSMUSG00000063889
AA Change: R202Q

DomainStartEndE-ValueType
Pfam:pKID 47 88 1.6e-20 PFAM
BRLZ 169 226 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131899
SMART Domains Protein: ENSMUSP00000119353
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
low complexity region 67 78 N/A INTRINSIC
Pfam:pKID 102 143 2.2e-20 PFAM
BRLZ 224 282 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134027
Predicted Effect probably damaging
Transcript: ENSMUST00000136961
AA Change: R241Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115363
Gene: ENSMUSG00000063889
AA Change: R241Q

DomainStartEndE-ValueType
Pfam:pKID 35 76 6.5e-21 PFAM
BRLZ 208 265 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137568
SMART Domains Protein: ENSMUSP00000115336
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
Pfam:pKID 53 94 1.5e-20 PFAM
BRLZ 163 221 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139537
SMART Domains Protein: ENSMUSP00000122123
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
BRLZ 35 93 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140332
AA Change: R81Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115423
Gene: ENSMUSG00000063889
AA Change: R81Q

DomainStartEndE-ValueType
BRLZ 48 105 2.73e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140912
Predicted Effect probably damaging
Transcript: ENSMUST00000144496
AA Change: R253Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120349
Gene: ENSMUSG00000063889
AA Change: R253Q

DomainStartEndE-ValueType
Pfam:pKID 35 76 6.9e-21 PFAM
BRLZ 220 277 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146265
AA Change: R245Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119638
Gene: ENSMUSG00000063889
AA Change: R245Q

DomainStartEndE-ValueType
low complexity region 67 78 N/A INTRINSIC
Pfam:pKID 102 143 2.1e-20 PFAM
BRLZ 212 269 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147138
AA Change: R93Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114280
Gene: ENSMUSG00000063889
AA Change: R93Q

DomainStartEndE-ValueType
BRLZ 60 117 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148305
Predicted Effect probably damaging
Transcript: ENSMUST00000150235
AA Change: R330Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121233
Gene: ENSMUSG00000063889
AA Change: R330Q

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 1.1e-20 PFAM
BRLZ 297 354 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151084
SMART Domains Protein: ENSMUSP00000118578
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
BRLZ 48 106 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151311
AA Change: R269Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118267
Gene: ENSMUSG00000063889
AA Change: R269Q

DomainStartEndE-ValueType
Pfam:pKID 63 104 7.5e-21 PFAM
BRLZ 236 293 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152108
AA Change: R190Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122241
Gene: ENSMUSG00000063889
AA Change: R190Q

DomainStartEndE-ValueType
Pfam:pKID 35 76 4.7e-21 PFAM
BRLZ 157 214 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152900
SMART Domains Protein: ENSMUSP00000123515
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
Pfam:pKID 53 94 2.4e-20 PFAM
BRLZ 238 296 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154135
SMART Domains Protein: ENSMUSP00000122051
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
Pfam:pKID 63 104 1.9e-20 PFAM
BRLZ 185 243 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154470
SMART Domains Protein: ENSMUSP00000118128
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 2.3e-20 PFAM
BRLZ 222 280 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154705
SMART Domains Protein: ENSMUSP00000119194
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
BRLZ 60 118 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154715
SMART Domains Protein: ENSMUSP00000122179
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
Pfam:pKID 84 125 8.7e-21 PFAM
BRLZ 269 327 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156234
SMART Domains Protein: ENSMUSP00000121388
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Pfam:pKID 96 137 9.1e-21 PFAM
BRLZ 281 339 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165086
SMART Domains Protein: ENSMUSP00000127353
Gene: ENSMUSG00000063889

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 2.4e-20 PFAM
BRLZ 234 292 3.8e-6 SMART
Meta Mutation Damage Score 0.4214 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene encodes a basic-leucine zipper domain-containing protein that localizes to gene promoters, where it binds to the cyclic AMP response element (CRE). Different protein isoforms encoded by this gene may function as either activators or repressors of transcription. Activity of this gene is important in multiple developmental processes, including spermatogenesis. Mutation of this gene causes male infertility. Alternative splicing and promoter usage result in multiple transcript variants for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygotes for targeted mutations exhibit reduced regenerative capacity after partial hepatectomy and reduced cardiac function. Males are sterile due to a block in spermiogenesis associated with a lack of postmeiotic gene expression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2ml1 T A 6: 128,549,836 K1071* probably null Het
Abca13 G T 11: 9,297,752 V2500F possibly damaging Het
Adamdec1 T C 14: 68,579,184 E85G probably damaging Het
Aldh8a1 T C 10: 21,389,071 V199A probably benign Het
Aoc2 G A 11: 101,325,801 V237M probably damaging Het
Aplp2 C T 9: 31,150,944 R672H probably damaging Het
Apob A G 12: 7,995,513 N886S probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Atp6v1a T C 16: 44,106,940 Y328C probably damaging Het
Bag4 T C 8: 25,777,493 Y103C probably damaging Het
Crybg1 A G 10: 43,956,760 S2000P probably damaging Het
Cubn T A 2: 13,325,184 T2629S probably benign Het
Cyhr1 C T 15: 76,658,858 R34Q probably damaging Het
Cyp3a44 G T 5: 145,777,946 S465Y probably damaging Het
Daam2 A C 17: 49,486,497 F331V probably damaging Het
Dnajc3 T C 14: 118,968,031 S146P possibly damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fam184b G A 5: 45,582,896 S316L probably benign Het
Fat2 G C 11: 55,253,934 T4038S probably damaging Het
Fbxl19 C T 7: 127,761,265 R439C probably damaging Het
Gm3454 T A 15: 75,311,599 noncoding transcript Het
Gpatch3 A G 4: 133,578,306 E284G probably benign Het
Grm1 A T 10: 10,719,805 I693N probably damaging Het
Gsdme T A 6: 50,245,954 Q127L probably damaging Het
Ifnlr1 A G 4: 135,705,626 K458E probably benign Het
Kcns2 T C 15: 34,838,934 F148L probably benign Het
Lama1 A G 17: 67,750,643 T571A probably benign Het
Loxhd1 G A 18: 77,381,558 V108M probably damaging Het
Mef2c A T 13: 83,662,359 T375S probably benign Het
Ncor1 A T 11: 62,373,321 D144E possibly damaging Het
Nos3 A T 5: 24,379,811 T738S probably benign Het
Nrxn2 A T 19: 6,517,132 T1353S probably damaging Het
Olfr1289 T C 2: 111,483,850 L140P probably damaging Het
Olfr146 A G 9: 39,018,965 I192T probably benign Het
Olfr1535 G T 13: 21,555,907 S38R probably benign Het
Pfpl A G 19: 12,429,383 T333A probably damaging Het
Postn A T 3: 54,376,716 I565F possibly damaging Het
Ppef2 A G 5: 92,230,524 V604A probably benign Het
Pramef12 A C 4: 144,393,028 I323S possibly damaging Het
Prmt1 A G 7: 44,977,102 probably null Het
Rel A G 11: 23,742,684 S450P probably benign Het
Rpap2 A C 5: 107,597,795 D3A probably damaging Het
Shisa9 T C 16: 11,984,908 F110L possibly damaging Het
Slc25a10 A T 11: 120,494,958 probably null Het
Slx4 A T 16: 3,980,157 F1454L probably damaging Het
Smc1b A T 15: 85,066,229 V1198D possibly damaging Het
Supt5 T C 7: 28,316,175 Y879C probably damaging Het
Tbx15 T C 3: 99,352,517 M568T probably benign Het
Tle4 T C 19: 14,452,108 H698R possibly damaging Het
Trappc9 T C 15: 72,925,530 N803D probably benign Het
Trim10 A T 17: 36,871,714 R157S possibly damaging Het
Wsb1 T C 11: 79,240,199 probably benign Het
Zfp106 T C 2: 120,535,393 S178G probably benign Het
Other mutations in Crem
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Crem APN 18 3299236 missense probably damaging 1.00
IGL01532:Crem APN 18 3276732 missense probably benign 0.02
IGL02500:Crem APN 18 3273477 missense probably damaging 1.00
IGL03280:Crem APN 18 3273415 splice site probably benign
menthe UTSW 18 3268070 missense probably damaging 1.00
R0379:Crem UTSW 18 3299226 missense probably damaging 1.00
R0987:Crem UTSW 18 3288060 missense probably damaging 0.98
R1829:Crem UTSW 18 3295037 splice site probably null
R1932:Crem UTSW 18 3299284 missense probably benign 0.27
R2086:Crem UTSW 18 3288098 intron probably benign
R2093:Crem UTSW 18 3299256 missense probably damaging 1.00
R4152:Crem UTSW 18 3288055 missense probably damaging 0.99
R4568:Crem UTSW 18 3299175 missense probably damaging 0.98
R4758:Crem UTSW 18 3327527 missense probably damaging 1.00
R6032:Crem UTSW 18 3267673 missense probably damaging 1.00
R6445:Crem UTSW 18 3309671 missense probably benign
R6525:Crem UTSW 18 3268070 missense probably damaging 1.00
R6651:Crem UTSW 18 3325428 missense probably benign 0.18
R7035:Crem UTSW 18 3327503 missense probably damaging 1.00
R7137:Crem UTSW 18 3273459 missense possibly damaging 0.89
R7401:Crem UTSW 18 3295329 missense probably damaging 1.00
R7463:Crem UTSW 18 3295094 missense probably benign 0.06
R7516:Crem UTSW 18 3299141 intron probably null
Z1176:Crem UTSW 18 3267730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCATAATTCTTGCCGGC -3'
(R):5'- TGGACTTGTAGATGGGTCTCTTAAC -3'

Sequencing Primer
(F):5'- GCCGGCTATATATTGTATTGCATTC -3'
(R):5'- ACCCTTGCTTAAGAATACAGTCTGC -3'
Posted On2017-08-16