Incidental Mutation 'R6033:Ccdc150'
ID486365
Institutional Source Beutler Lab
Gene Symbol Ccdc150
Ensembl Gene ENSMUSG00000025983
Gene Namecoiled-coil domain containing 150
Synonyms4930511H11Rik
MMRRC Submission 044205-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6033 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location54250683-54368727 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 54285628 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027128] [ENSMUST00000160472]
Predicted Effect probably null
Transcript: ENSMUST00000027128
SMART Domains Protein: ENSMUSP00000027128
Gene: ENSMUSG00000025983

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 676 N/A INTRINSIC
coiled coil region 727 952 N/A INTRINSIC
coiled coil region 985 1048 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160472
SMART Domains Protein: ENSMUSP00000125195
Gene: ENSMUSG00000025983

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 551 N/A INTRINSIC
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,372 E72G probably damaging Het
Adgrl1 T A 8: 83,918,922 V58E probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alas1 A G 9: 106,241,204 S240P probably damaging Het
Alox12e C T 11: 70,316,013 G616D probably benign Het
Arhgap8 A G 15: 84,741,925 E67G probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Cmtm8 T C 9: 114,796,073 T97A probably damaging Het
Cnmd T C 14: 79,661,505 S36G probably benign Het
Dnah3 A C 7: 120,071,647 N609K probably benign Het
Dph1 C T 11: 75,191,197 probably benign Het
Drosha G A 15: 12,925,999 A1225T probably benign Het
Eid3 T A 10: 82,867,653 I316K probably damaging Het
Erich6 A G 3: 58,623,201 L449S probably benign Het
Fhod1 T C 8: 105,336,434 probably benign Het
Glra1 A G 11: 55,527,419 Y250H probably damaging Het
Gm21972 T C 1: 86,137,095 Y950H probably damaging Het
Gm6712 T A 17: 17,294,416 noncoding transcript Het
Gm6768 A G 12: 119,261,740 noncoding transcript Het
Grb7 C T 11: 98,455,197 probably null Het
Hivep1 A G 13: 42,157,107 E941G probably benign Het
Homer2 A C 7: 81,618,679 S78A possibly damaging Het
Ica1 T A 6: 8,630,799 probably null Het
Ifna12 T C 4: 88,602,917 E131G possibly damaging Het
Igbp1b T C 6: 138,658,209 Y79C probably damaging Het
Incenp C T 19: 9,872,697 V871I probably damaging Het
Jaml G A 9: 45,088,710 G60D probably damaging Het
Kcp C T 6: 29,493,194 C110Y probably damaging Het
Manba T C 3: 135,549,261 V460A probably benign Het
Myrfl A T 10: 116,849,101 C125S probably benign Het
Ncan T C 8: 70,112,590 D229G probably damaging Het
Nlrp10 A T 7: 108,924,577 D565E probably benign Het
Npas2 T C 1: 39,338,180 V541A probably damaging Het
Nsg2 G A 11: 32,055,058 V87M possibly damaging Het
Olfr1040 A T 2: 86,146,269 V155E probably damaging Het
Prkd2 C T 7: 16,865,714 R701C probably damaging Het
Prr3 A T 17: 35,978,624 probably null Het
Prss36 T C 7: 127,934,567 R22G probably benign Het
Slc45a4 G A 15: 73,581,976 A716V probably damaging Het
Slc46a1 T C 11: 78,466,007 probably null Het
Slc6a5 T C 7: 49,959,351 I768T probably benign Het
Slco6c1 C T 1: 97,081,316 probably null Het
Taar2 A T 10: 23,940,976 H138L probably benign Het
Taf2 A C 15: 55,058,901 L330R probably damaging Het
Tgm5 T C 2: 121,070,729 probably null Het
Tmed4 A T 11: 6,274,491 Y56* probably null Het
Tmem156 A T 5: 65,075,621 F135L probably benign Het
Ttll6 T C 11: 96,134,887 S65P probably damaging Het
Ttn C T 2: 76,726,827 G28199R probably damaging Het
Ubn2 T A 6: 38,470,224 probably null Het
Unc80 A T 1: 66,473,260 T110S possibly damaging Het
Vmn2r72 A T 7: 85,737,929 V809E probably damaging Het
Zbtb2 A G 10: 4,368,599 F476L probably damaging Het
Zbtb24 T C 10: 41,464,401 F498L probably damaging Het
Zfp280d T A 9: 72,329,137 L494Q probably damaging Het
Zfp281 T C 1: 136,626,726 S481P probably benign Het
Other mutations in Ccdc150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Ccdc150 APN 1 54272550 splice site probably benign
IGL00819:Ccdc150 APN 1 54263573 missense probably damaging 1.00
IGL01973:Ccdc150 APN 1 54300488 splice site probably null
IGL02352:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02359:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02620:Ccdc150 APN 1 54263545 nonsense probably null
IGL02673:Ccdc150 APN 1 54328990 missense probably benign 0.09
IGL03148:Ccdc150 APN 1 54278715 missense possibly damaging 0.68
IGL03185:Ccdc150 APN 1 54300323 missense probably damaging 1.00
IGL03014:Ccdc150 UTSW 1 54290702 missense probably damaging 0.99
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0217:Ccdc150 UTSW 1 54300430 missense possibly damaging 0.87
R0582:Ccdc150 UTSW 1 54329511 missense probably benign
R0687:Ccdc150 UTSW 1 54285631 splice site probably null
R0790:Ccdc150 UTSW 1 54277776 splice site probably benign
R1146:Ccdc150 UTSW 1 54364971 splice site probably benign
R1288:Ccdc150 UTSW 1 54364458 missense probably damaging 1.00
R1763:Ccdc150 UTSW 1 54354636 missense probably benign 0.42
R1855:Ccdc150 UTSW 1 54367910 intron probably benign
R1957:Ccdc150 UTSW 1 54263909 missense probably benign 0.00
R2180:Ccdc150 UTSW 1 54272547 critical splice donor site probably null
R2226:Ccdc150 UTSW 1 54364925 missense probably null 0.11
R3054:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3055:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3056:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3409:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3411:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3812:Ccdc150 UTSW 1 54368310 missense probably benign 0.00
R4031:Ccdc150 UTSW 1 54278811 missense probably benign 0.31
R4356:Ccdc150 UTSW 1 54353054 missense probably damaging 0.98
R4617:Ccdc150 UTSW 1 54355754 missense probably benign 0.00
R4757:Ccdc150 UTSW 1 54278715 missense possibly damaging 0.81
R4957:Ccdc150 UTSW 1 54364868 intron probably benign
R5028:Ccdc150 UTSW 1 54263477 missense probably benign 0.01
R5512:Ccdc150 UTSW 1 54354647 missense probably damaging 0.96
R5757:Ccdc150 UTSW 1 54263620 missense probably damaging 1.00
R5943:Ccdc150 UTSW 1 54300367 missense probably benign 0.01
R5948:Ccdc150 UTSW 1 54277714 missense possibly damaging 0.79
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6065:Ccdc150 UTSW 1 54263599 missense possibly damaging 0.90
R6390:Ccdc150 UTSW 1 54368017 missense probably benign 0.01
R6399:Ccdc150 UTSW 1 54263957 splice site probably null
R6988:Ccdc150 UTSW 1 54355709 nonsense probably null
R7248:Ccdc150 UTSW 1 54304898 missense probably benign 0.00
R7319:Ccdc150 UTSW 1 54263337 splice site probably null
R7322:Ccdc150 UTSW 1 54259966 missense probably benign 0.01
R7366:Ccdc150 UTSW 1 54300382 nonsense probably null
R7647:Ccdc150 UTSW 1 54356704 missense probably damaging 1.00
R7981:Ccdc150 UTSW 1 54368392 missense probably damaging 1.00
R8002:Ccdc150 UTSW 1 54272497 missense probably damaging 0.99
R8201:Ccdc150 UTSW 1 54329487 missense probably benign 0.10
R8688:Ccdc150 UTSW 1 54367973 missense not run
R8719:Ccdc150 UTSW 1 54263509 missense not run
Predicted Primers PCR Primer
(F):5'- ATGCACAAGTGGACACTGATAG -3'
(R):5'- CTTGTGTACCACAGAGTCAAAGG -3'

Sequencing Primer
(F):5'- CACTGATAGTGGTCAGAATACAGACC -3'
(R):5'- TGTACCACAGAGTCAAAGGAATTTG -3'
Posted On2017-08-16