Incidental Mutation 'R6033:Slco6c1'
ID486368
Institutional Source Beutler Lab
Gene Symbol Slco6c1
Ensembl Gene ENSMUSG00000026331
Gene Namesolute carrier organic anion transporter family, member 6c1
Synonyms4933404A18Rik
MMRRC Submission 044205-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6033 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location97059038-97128301 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 97081316 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027569] [ENSMUST00000189547]
Predicted Effect probably null
Transcript: ENSMUST00000027569
SMART Domains Protein: ENSMUSP00000027569
Gene: ENSMUSG00000026331

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
Pfam:OATP 95 654 3e-101 PFAM
Pfam:MFS_1 207 474 6.5e-14 PFAM
Pfam:Kazal_2 497 538 7.4e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000189547
SMART Domains Protein: ENSMUSP00000140791
Gene: ENSMUSG00000026331

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
Pfam:OATP 93 197 7.4e-12 PFAM
Pfam:MFS_1 99 457 2.2e-15 PFAM
Pfam:OATP 192 638 2.5e-64 PFAM
Pfam:Kazal_2 480 521 2.1e-8 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,372 E72G probably damaging Het
Adgrl1 T A 8: 83,918,922 V58E probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alas1 A G 9: 106,241,204 S240P probably damaging Het
Alox12e C T 11: 70,316,013 G616D probably benign Het
Arhgap8 A G 15: 84,741,925 E67G probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Ccdc150 G T 1: 54,285,628 probably null Het
Cmtm8 T C 9: 114,796,073 T97A probably damaging Het
Cnmd T C 14: 79,661,505 S36G probably benign Het
Dnah3 A C 7: 120,071,647 N609K probably benign Het
Dph1 C T 11: 75,191,197 probably benign Het
Drosha G A 15: 12,925,999 A1225T probably benign Het
Eid3 T A 10: 82,867,653 I316K probably damaging Het
Erich6 A G 3: 58,623,201 L449S probably benign Het
Fhod1 T C 8: 105,336,434 probably benign Het
Glra1 A G 11: 55,527,419 Y250H probably damaging Het
Gm21972 T C 1: 86,137,095 Y950H probably damaging Het
Gm6712 T A 17: 17,294,416 noncoding transcript Het
Gm6768 A G 12: 119,261,740 noncoding transcript Het
Grb7 C T 11: 98,455,197 probably null Het
Hivep1 A G 13: 42,157,107 E941G probably benign Het
Homer2 A C 7: 81,618,679 S78A possibly damaging Het
Ica1 T A 6: 8,630,799 probably null Het
Ifna12 T C 4: 88,602,917 E131G possibly damaging Het
Igbp1b T C 6: 138,658,209 Y79C probably damaging Het
Incenp C T 19: 9,872,697 V871I probably damaging Het
Jaml G A 9: 45,088,710 G60D probably damaging Het
Kcp C T 6: 29,493,194 C110Y probably damaging Het
Manba T C 3: 135,549,261 V460A probably benign Het
Myrfl A T 10: 116,849,101 C125S probably benign Het
Ncan T C 8: 70,112,590 D229G probably damaging Het
Nlrp10 A T 7: 108,924,577 D565E probably benign Het
Npas2 T C 1: 39,338,180 V541A probably damaging Het
Nsg2 G A 11: 32,055,058 V87M possibly damaging Het
Olfr1040 A T 2: 86,146,269 V155E probably damaging Het
Prkd2 C T 7: 16,865,714 R701C probably damaging Het
Prr3 A T 17: 35,978,624 probably null Het
Prss36 T C 7: 127,934,567 R22G probably benign Het
Slc45a4 G A 15: 73,581,976 A716V probably damaging Het
Slc46a1 T C 11: 78,466,007 probably null Het
Slc6a5 T C 7: 49,959,351 I768T probably benign Het
Taar2 A T 10: 23,940,976 H138L probably benign Het
Taf2 A C 15: 55,058,901 L330R probably damaging Het
Tgm5 T C 2: 121,070,729 probably null Het
Tmed4 A T 11: 6,274,491 Y56* probably null Het
Tmem156 A T 5: 65,075,621 F135L probably benign Het
Ttll6 T C 11: 96,134,887 S65P probably damaging Het
Ttn C T 2: 76,726,827 G28199R probably damaging Het
Ubn2 T A 6: 38,470,224 probably null Het
Unc80 A T 1: 66,473,260 T110S possibly damaging Het
Vmn2r72 A T 7: 85,737,929 V809E probably damaging Het
Zbtb2 A G 10: 4,368,599 F476L probably damaging Het
Zbtb24 T C 10: 41,464,401 F498L probably damaging Het
Zfp280d T A 9: 72,329,137 L494Q probably damaging Het
Zfp281 T C 1: 136,626,726 S481P probably benign Het
Other mutations in Slco6c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Slco6c1 APN 1 97087949 missense probably benign 0.00
IGL00571:Slco6c1 APN 1 97087951 missense probably benign 0.04
IGL01483:Slco6c1 APN 1 97128107 missense probably benign
IGL01543:Slco6c1 APN 1 97125828 missense possibly damaging 0.95
IGL01860:Slco6c1 APN 1 97075823 splice site probably benign
IGL03106:Slco6c1 APN 1 97066023 splice site probably benign
R0087:Slco6c1 UTSW 1 97118578 missense probably benign 0.00
R0543:Slco6c1 UTSW 1 97127898 missense probably damaging 0.99
R0674:Slco6c1 UTSW 1 97104773 splice site probably benign
R0826:Slco6c1 UTSW 1 97128101 missense probably benign 0.00
R0928:Slco6c1 UTSW 1 97104848 missense possibly damaging 0.88
R0969:Slco6c1 UTSW 1 97119960 missense probably benign 0.05
R1366:Slco6c1 UTSW 1 97128203 start gained probably null
R1559:Slco6c1 UTSW 1 97098498 missense probably damaging 1.00
R1594:Slco6c1 UTSW 1 97062438 missense probably benign 0.36
R1901:Slco6c1 UTSW 1 97072982 missense probably damaging 0.98
R2005:Slco6c1 UTSW 1 97081489 missense probably damaging 0.99
R2101:Slco6c1 UTSW 1 97072870 nonsense probably null
R2102:Slco6c1 UTSW 1 97127931 missense probably benign 0.02
R2120:Slco6c1 UTSW 1 97066083 missense possibly damaging 0.57
R2135:Slco6c1 UTSW 1 97104817 missense probably benign 0.01
R2295:Slco6c1 UTSW 1 97125748 missense probably damaging 1.00
R2437:Slco6c1 UTSW 1 97062476 missense probably benign 0.22
R4004:Slco6c1 UTSW 1 97075885 missense probably damaging 1.00
R4133:Slco6c1 UTSW 1 97081493 missense probably benign 0.02
R4643:Slco6c1 UTSW 1 97062424 missense probably benign 0.00
R4786:Slco6c1 UTSW 1 97087995 missense probably benign 0.04
R4942:Slco6c1 UTSW 1 97081324 missense probably damaging 1.00
R5485:Slco6c1 UTSW 1 97125756 missense probably damaging 1.00
R5573:Slco6c1 UTSW 1 97127931 missense probably benign 0.00
R5810:Slco6c1 UTSW 1 97075873 missense probably damaging 1.00
R6033:Slco6c1 UTSW 1 97081316 splice site probably null
R6191:Slco6c1 UTSW 1 97066083 missense possibly damaging 0.57
R6197:Slco6c1 UTSW 1 97072793 critical splice donor site probably null
R6286:Slco6c1 UTSW 1 97125720 missense possibly damaging 0.90
R6404:Slco6c1 UTSW 1 97118605 missense probably damaging 1.00
R6430:Slco6c1 UTSW 1 97075974 missense probably benign 0.43
R6492:Slco6c1 UTSW 1 97125813 missense probably damaging 0.99
R6649:Slco6c1 UTSW 1 97125711 missense probably benign 0.44
R6940:Slco6c1 UTSW 1 97072901 missense possibly damaging 0.80
R7138:Slco6c1 UTSW 1 97119981 missense possibly damaging 0.95
R7213:Slco6c1 UTSW 1 97127946 missense probably benign
R7234:Slco6c1 UTSW 1 97125741 missense probably benign 0.06
R7320:Slco6c1 UTSW 1 97128162 missense possibly damaging 0.83
R7375:Slco6c1 UTSW 1 97081421 missense possibly damaging 0.58
R7383:Slco6c1 UTSW 1 97075883 nonsense probably null
R7422:Slco6c1 UTSW 1 97081482 missense probably benign 0.17
R7491:Slco6c1 UTSW 1 97127854 missense probably benign 0.32
R7561:Slco6c1 UTSW 1 97072966 missense probably damaging 1.00
R7890:Slco6c1 UTSW 1 97062467 missense possibly damaging 0.59
R8115:Slco6c1 UTSW 1 97072961 missense probably damaging 1.00
R8409:Slco6c1 UTSW 1 97075938 missense probably damaging 0.99
R8422:Slco6c1 UTSW 1 97125783 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGAATGTGACCTGATCTCTCTACC -3'
(R):5'- ACTTCCTGGAGGCATAATTGG -3'

Sequencing Primer
(F):5'- TGATCACAAATGACTCATGAATGC -3'
(R):5'- GGCATAATTGGCCATTTTCTTGG -3'
Posted On2017-08-16