Incidental Mutation 'R0522:Nek5'
Institutional Source Beutler Lab
Gene Symbol Nek5
Ensembl Gene ENSMUSG00000037738
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 5
MMRRC Submission 038715-MU
Accession Numbers

Genbank: NM_177898.4; Ensembl: ENSMUST00000081815, ENSMUST00000169834

Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0522 (G1)
Quality Score214
Status Validated
Chromosomal Location22073616-22125053 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 22088797 bp
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000169834] [ENSMUST00000209656]
Predicted Effect probably benign
Transcript: ENSMUST00000169834
SMART Domains Protein: ENSMUSP00000126705
Gene: ENSMUSG00000037738

S_TKc 4 255 3.77e-92 SMART
Blast:S_TKc 396 497 3e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000209656
Predicted Effect probably benign
Transcript: ENSMUST00000210824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213644
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit progressive hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik A C 1: 181,059,747 D299A probably damaging Het
Adgre5 A G 8: 83,730,176 I192T probably benign Het
Adgrl3 T C 5: 81,726,801 Y982H possibly damaging Het
Adgrv1 T A 13: 81,528,442 probably benign Het
Alms1 T C 6: 85,621,615 V1610A probably benign Het
Ankrd24 T C 10: 81,636,355 probably benign Het
C2cd3 A G 7: 100,395,222 N337S probably benign Het
Cdc40 T C 10: 40,857,612 Y114C probably benign Het
Cdhr1 A T 14: 37,094,000 probably null Het
Cfc1 G A 1: 34,537,153 C98Y probably damaging Het
Cyp11b2 A T 15: 74,851,684 probably benign Het
Cyth4 C A 15: 78,615,785 H255Q possibly damaging Het
Dip2a T C 10: 76,321,531 K80R probably benign Het
Dnajb5 G T 4: 42,957,083 D257Y probably damaging Het
Dynll1 T C 5: 115,300,506 probably benign Het
Edn1 T A 13: 42,304,954 V81E probably damaging Het
F5 T C 1: 164,211,763 S1981P probably damaging Het
Fam186b T A 15: 99,280,519 M309L probably benign Het
Gm14221 G A 2: 160,574,677 noncoding transcript Het
Gnptab T A 10: 88,431,466 probably benign Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Gpr176 A G 2: 118,284,012 C106R probably damaging Het
Hdac7 A T 15: 97,806,679 probably null Het
Hlx T C 1: 184,731,640 S168G probably damaging Het
Hnf1a G T 5: 114,950,688 probably benign Het
Hp1bp3 C T 4: 138,222,161 L19F possibly damaging Het
Hspa14 T A 2: 3,511,049 T63S probably damaging Het
Insrr C T 3: 87,800,872 S207F probably damaging Het
Jak3 C A 8: 71,682,274 probably benign Het
Jmjd7 G A 2: 120,030,341 A91T probably damaging Het
Lgals9 G T 11: 78,965,812 H265Q possibly damaging Het
Lrriq1 T G 10: 103,161,777 N1326H probably damaging Het
Mdn1 C A 4: 32,672,837 Q486K probably benign Het
Mpeg1 A G 19: 12,461,759 T194A probably damaging Het
Pcgf2 A C 11: 97,692,047 I135M probably benign Het
Phactr1 G T 13: 43,059,591 A222S probably benign Het
Pla2r1 T C 2: 60,479,515 S575G probably benign Het
Plcg2 T C 8: 117,614,288 probably null Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Polg A G 7: 79,460,151 probably benign Het
Poteg T G 8: 27,449,958 L48V possibly damaging Het
Prmt1 A T 7: 44,981,779 C50S probably benign Het
Prx T A 7: 27,518,195 V707E probably damaging Het
Rrp12 C T 19: 41,874,705 probably benign Het
Saxo1 A T 4: 86,445,103 V381E probably damaging Het
Sh2d2a T C 3: 87,847,109 probably null Het
Slc26a5 A C 5: 21,846,345 I57R probably damaging Het
Slc38a3 T A 9: 107,655,213 probably null Het
Slc5a4b T C 10: 76,090,700 T188A probably damaging Het
Slc7a13 A G 4: 19,824,010 I260V probably benign Het
Smg8 A T 11: 87,086,462 S98T probably benign Het
Spg20 T A 3: 55,128,365 S548R probably damaging Het
Sult6b1 C T 17: 78,905,529 G98S probably damaging Het
Tbc1d2 A G 4: 46,649,806 Y77H probably damaging Het
Tet2 T A 3: 133,466,804 D1899V probably damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Uap1l1 T C 2: 25,363,277 E382G probably damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Ugt1a9 T C 1: 88,071,392 V188A probably damaging Het
Virma T C 4: 11,519,416 probably null Het
Xrcc6 T C 15: 82,022,592 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Zfp804b T A 5: 6,772,014 T350S probably benign Het
Zfp959 G T 17: 55,896,201 R61M probably null Het
Other mutations in Nek5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Nek5 APN 8 22111183 missense possibly damaging 0.75
IGL01418:Nek5 APN 8 22095269 missense probably damaging 1.00
IGL01485:Nek5 APN 8 22083369 missense probably benign 0.05
IGL01640:Nek5 APN 8 22120840 missense probably benign 0.00
IGL01894:Nek5 APN 8 22113819 missense probably damaging 1.00
IGL01958:Nek5 APN 8 22096826 missense probably benign 0.09
IGL02332:Nek5 APN 8 22095261 missense probably benign 0.14
IGL02718:Nek5 APN 8 22097463 missense probably benign 0.15
IGL03203:Nek5 APN 8 22118768 missense probably damaging 1.00
IGL03325:Nek5 APN 8 22079142 missense probably benign
R0257:Nek5 UTSW 8 22123672 intron probably benign
R0525:Nek5 UTSW 8 22079077 unclassified probably benign
R1476:Nek5 UTSW 8 22096731 missense possibly damaging 0.86
R1483:Nek5 UTSW 8 22096790 missense probably benign 0.30
R1764:Nek5 UTSW 8 22109912 missense probably damaging 0.98
R1892:Nek5 UTSW 8 22107729 missense probably benign 0.11
R1989:Nek5 UTSW 8 22111169 missense probably damaging 1.00
R2229:Nek5 UTSW 8 22113632 missense possibly damaging 0.76
R4114:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4116:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4709:Nek5 UTSW 8 22083427 missense probably damaging 0.99
R4952:Nek5 UTSW 8 22079088 missense probably benign 0.00
R4952:Nek5 UTSW 8 22096799 missense probably benign 0.00
R5185:Nek5 UTSW 8 22083381 missense possibly damaging 0.78
R5816:Nek5 UTSW 8 22096736 missense probably benign 0.02
R5884:Nek5 UTSW 8 22088801 critical splice donor site probably null
R6009:Nek5 UTSW 8 22120822 missense probably benign 0.00
R6279:Nek5 UTSW 8 22107721 missense probably benign
R6300:Nek5 UTSW 8 22107721 missense probably benign
R6437:Nek5 UTSW 8 22085460 missense possibly damaging 0.95
R7034:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7036:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7278:Nek5 UTSW 8 22090484 missense probably benign 0.13
R7436:Nek5 UTSW 8 22108040 missense probably damaging 1.00
R7666:Nek5 UTSW 8 22090517 missense probably benign 0.12
R7827:Nek5 UTSW 8 22083387 missense possibly damaging 0.91
R8057:Nek5 UTSW 8 22088906 missense probably benign 0.21
R8350:Nek5 UTSW 8 22113672 missense probably damaging 0.98
R8847:Nek5 UTSW 8 22123579 missense probably benign 0.01
R8888:Nek5 UTSW 8 22090479 critical splice donor site probably null
R8933:Nek5 UTSW 8 22111210 missense probably damaging 1.00
R8933:Nek5 UTSW 8 22120843 missense probably damaging 1.00
X0012:Nek5 UTSW 8 22095248 missense possibly damaging 0.92
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- aaggacattggaagaagggag -3'
Posted On2013-06-12