Incidental Mutation 'R6033:Prss36'
ID486388
Institutional Source Beutler Lab
Gene Symbol Prss36
Ensembl Gene ENSMUSG00000070371
Gene Nameprotease, serine 36
Synonymspolyserase-2, C330007D15Rik
MMRRC Submission 044205-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6033 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127932638-127946725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127934567 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 22 (R22G)
Ref Sequence ENSEMBL: ENSMUSP00000121706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032988] [ENSMUST00000094026] [ENSMUST00000118755] [ENSMUST00000141385] [ENSMUST00000156152] [ENSMUST00000206124] [ENSMUST00000206568]
Predicted Effect probably benign
Transcript: ENSMUST00000032988
SMART Domains Protein: ENSMUSP00000032988
Gene: ENSMUSG00000030800

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Tryp_SPc 44 281 3.55e-98 SMART
low complexity region 320 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094026
AA Change: R534G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000091565
Gene: ENSMUSG00000070371
AA Change: R534G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 47 287 3.75e-88 SMART
Pfam:Trypsin 325 556 1.2e-16 PFAM
Pfam:Trypsin 599 798 6.6e-20 PFAM
Pfam:DUF1986 607 707 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118755
AA Change: R523G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112659
Gene: ENSMUSG00000070371
AA Change: R523G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 47 287 3.75e-88 SMART
Pfam:Trypsin 325 545 9.7e-18 PFAM
Pfam:Trypsin 588 787 6.5e-20 PFAM
Pfam:DUF1986 590 696 8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141385
AA Change: R22G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000120544
Gene: ENSMUSG00000070371
AA Change: R22G

DomainStartEndE-ValueType
Blast:Tryp_SPc 38 121 3e-44 BLAST
SCOP:d1eaxa_ 45 126 7e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144192
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150591
SMART Domains Protein: ENSMUSP00000121532
Gene: ENSMUSG00000070371

DomainStartEndE-ValueType
Tryp_SPc 15 194 6.48e-2 SMART
Blast:Tryp_SPc 231 311 4e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153110
Predicted Effect probably benign
Transcript: ENSMUST00000156152
AA Change: R22G

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121706
Gene: ENSMUSG00000070371
AA Change: R22G

DomainStartEndE-ValueType
Blast:Tryp_SPc 2 44 1e-21 BLAST
Tryp_SPc 89 238 8.18e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206124
Predicted Effect probably benign
Transcript: ENSMUST00000206568
Meta Mutation Damage Score 0.5850 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,372 E72G probably damaging Het
Adgrl1 T A 8: 83,918,922 V58E probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alas1 A G 9: 106,241,204 S240P probably damaging Het
Alox12e C T 11: 70,316,013 G616D probably benign Het
Arhgap8 A G 15: 84,741,925 E67G probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Ccdc150 G T 1: 54,285,628 probably null Het
Cmtm8 T C 9: 114,796,073 T97A probably damaging Het
Cnmd T C 14: 79,661,505 S36G probably benign Het
Dnah3 A C 7: 120,071,647 N609K probably benign Het
Dph1 C T 11: 75,191,197 probably benign Het
Drosha G A 15: 12,925,999 A1225T probably benign Het
Eid3 T A 10: 82,867,653 I316K probably damaging Het
Erich6 A G 3: 58,623,201 L449S probably benign Het
Fhod1 T C 8: 105,336,434 probably benign Het
Glra1 A G 11: 55,527,419 Y250H probably damaging Het
Gm21972 T C 1: 86,137,095 Y950H probably damaging Het
Gm6712 T A 17: 17,294,416 noncoding transcript Het
Gm6768 A G 12: 119,261,740 noncoding transcript Het
Grb7 C T 11: 98,455,197 probably null Het
Hivep1 A G 13: 42,157,107 E941G probably benign Het
Homer2 A C 7: 81,618,679 S78A possibly damaging Het
Ica1 T A 6: 8,630,799 probably null Het
Ifna12 T C 4: 88,602,917 E131G possibly damaging Het
Igbp1b T C 6: 138,658,209 Y79C probably damaging Het
Incenp C T 19: 9,872,697 V871I probably damaging Het
Jaml G A 9: 45,088,710 G60D probably damaging Het
Kcp C T 6: 29,493,194 C110Y probably damaging Het
Manba T C 3: 135,549,261 V460A probably benign Het
Myrfl A T 10: 116,849,101 C125S probably benign Het
Ncan T C 8: 70,112,590 D229G probably damaging Het
Nlrp10 A T 7: 108,924,577 D565E probably benign Het
Npas2 T C 1: 39,338,180 V541A probably damaging Het
Nsg2 G A 11: 32,055,058 V87M possibly damaging Het
Olfr1040 A T 2: 86,146,269 V155E probably damaging Het
Prkd2 C T 7: 16,865,714 R701C probably damaging Het
Prr3 A T 17: 35,978,624 probably null Het
Slc45a4 G A 15: 73,581,976 A716V probably damaging Het
Slc46a1 T C 11: 78,466,007 probably null Het
Slc6a5 T C 7: 49,959,351 I768T probably benign Het
Slco6c1 C T 1: 97,081,316 probably null Het
Taar2 A T 10: 23,940,976 H138L probably benign Het
Taf2 A C 15: 55,058,901 L330R probably damaging Het
Tgm5 T C 2: 121,070,729 probably null Het
Tmed4 A T 11: 6,274,491 Y56* probably null Het
Tmem156 A T 5: 65,075,621 F135L probably benign Het
Ttll6 T C 11: 96,134,887 S65P probably damaging Het
Ttn C T 2: 76,726,827 G28199R probably damaging Het
Ubn2 T A 6: 38,470,224 probably null Het
Unc80 A T 1: 66,473,260 T110S possibly damaging Het
Vmn2r72 A T 7: 85,737,929 V809E probably damaging Het
Zbtb2 A G 10: 4,368,599 F476L probably damaging Het
Zbtb24 T C 10: 41,464,401 F498L probably damaging Het
Zfp280d T A 9: 72,329,137 L494Q probably damaging Het
Zfp281 T C 1: 136,626,726 S481P probably benign Het
Other mutations in Prss36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Prss36 APN 7 127944927 splice site probably benign
IGL01473:Prss36 APN 7 127944701 missense probably damaging 0.98
IGL03139:Prss36 APN 7 127933611 missense probably damaging 1.00
R0111:Prss36 UTSW 7 127934545 missense probably damaging 1.00
R0295:Prss36 UTSW 7 127935855 missense possibly damaging 0.80
R1771:Prss36 UTSW 7 127933453 missense probably damaging 1.00
R1827:Prss36 UTSW 7 127933492 missense probably damaging 1.00
R3935:Prss36 UTSW 7 127934608 missense probably damaging 1.00
R4257:Prss36 UTSW 7 127932838 unclassified probably benign
R4694:Prss36 UTSW 7 127935615 missense probably damaging 1.00
R5384:Prss36 UTSW 7 127936699 missense probably damaging 1.00
R5464:Prss36 UTSW 7 127934233 missense probably damaging 1.00
R5524:Prss36 UTSW 7 127934465 nonsense probably null
R5749:Prss36 UTSW 7 127933642 missense probably damaging 1.00
R5905:Prss36 UTSW 7 127933572 missense probably benign 0.26
R5992:Prss36 UTSW 7 127944830 missense probably damaging 1.00
R6033:Prss36 UTSW 7 127934567 missense probably benign 0.07
R6971:Prss36 UTSW 7 127945238 missense probably benign 0.15
R7050:Prss36 UTSW 7 127944765 missense possibly damaging 0.71
R7232:Prss36 UTSW 7 127935591 missense probably benign 0.07
R7271:Prss36 UTSW 7 127944705 missense probably benign 0.10
Z1088:Prss36 UTSW 7 127934537 nonsense probably null
Z1177:Prss36 UTSW 7 127933833 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCCAGGACCTAAGAATTACCAGG -3'
(R):5'- ACTGGAACTTGGCTTGAAGGG -3'

Sequencing Primer
(F):5'- TCACCACCGTGCTCAGTATGTG -3'
(R):5'- CTTGAAGGGTTCTTGCAGGAAAG -3'
Posted On2017-08-16