Incidental Mutation 'R6033:Zbtb24'
ID486398
Institutional Source Beutler Lab
Gene Symbol Zbtb24
Ensembl Gene ENSMUSG00000019826
Gene Namezinc finger and BTB domain containing 24
SynonymsZNF450
MMRRC Submission 044205-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6033 (G1)
Quality Score154.008
Status Validated
Chromosome10
Chromosomal Location41450383-41465574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41464401 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 498 (F498L)
Ref Sequence ENSEMBL: ENSMUSP00000079592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080771] [ENSMUST00000213797]
Predicted Effect probably damaging
Transcript: ENSMUST00000080771
AA Change: F498L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079592
Gene: ENSMUSG00000019826
AA Change: F498L

DomainStartEndE-ValueType
BTB 37 133 5.81e-26 SMART
AT_hook 159 171 2.23e-1 SMART
low complexity region 248 260 N/A INTRINSIC
ZnF_C2H2 293 315 8.67e-1 SMART
ZnF_C2H2 321 343 4.87e-4 SMART
ZnF_C2H2 349 371 6.42e-4 SMART
ZnF_C2H2 377 399 2.99e-4 SMART
ZnF_C2H2 405 427 9.44e-2 SMART
ZnF_C2H2 433 455 3.26e-5 SMART
ZnF_C2H2 461 483 2.36e-2 SMART
ZnF_C2H2 489 511 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000213797
AA Change: F476L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215881
Meta Mutation Damage Score 0.4673 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes a protein containing eight C2H2-type zinc fingers and a BTB domain. Expression of this gene is induced by bone morphogenetic protein-2 signaling. Mutation of the related gene in humans causes immunodeficiency-centromeric instability-facial anomalies syndrome-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a deletion in the BTB domain exhibit embryonic lethality between E4.5 and E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,372 E72G probably damaging Het
Adgrl1 T A 8: 83,918,922 V58E probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alas1 A G 9: 106,241,204 S240P probably damaging Het
Alox12e C T 11: 70,316,013 G616D probably benign Het
Arhgap8 A G 15: 84,741,925 E67G probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Ccdc150 G T 1: 54,285,628 probably null Het
Cmtm8 T C 9: 114,796,073 T97A probably damaging Het
Cnmd T C 14: 79,661,505 S36G probably benign Het
Dnah3 A C 7: 120,071,647 N609K probably benign Het
Dph1 C T 11: 75,191,197 probably benign Het
Drosha G A 15: 12,925,999 A1225T probably benign Het
Eid3 T A 10: 82,867,653 I316K probably damaging Het
Erich6 A G 3: 58,623,201 L449S probably benign Het
Fhod1 T C 8: 105,336,434 probably benign Het
Glra1 A G 11: 55,527,419 Y250H probably damaging Het
Gm21972 T C 1: 86,137,095 Y950H probably damaging Het
Gm6712 T A 17: 17,294,416 noncoding transcript Het
Gm6768 A G 12: 119,261,740 noncoding transcript Het
Grb7 C T 11: 98,455,197 probably null Het
Hivep1 A G 13: 42,157,107 E941G probably benign Het
Homer2 A C 7: 81,618,679 S78A possibly damaging Het
Ica1 T A 6: 8,630,799 probably null Het
Ifna12 T C 4: 88,602,917 E131G possibly damaging Het
Igbp1b T C 6: 138,658,209 Y79C probably damaging Het
Incenp C T 19: 9,872,697 V871I probably damaging Het
Jaml G A 9: 45,088,710 G60D probably damaging Het
Kcp C T 6: 29,493,194 C110Y probably damaging Het
Manba T C 3: 135,549,261 V460A probably benign Het
Myrfl A T 10: 116,849,101 C125S probably benign Het
Ncan T C 8: 70,112,590 D229G probably damaging Het
Nlrp10 A T 7: 108,924,577 D565E probably benign Het
Npas2 T C 1: 39,338,180 V541A probably damaging Het
Nsg2 G A 11: 32,055,058 V87M possibly damaging Het
Olfr1040 A T 2: 86,146,269 V155E probably damaging Het
Prkd2 C T 7: 16,865,714 R701C probably damaging Het
Prr3 A T 17: 35,978,624 probably null Het
Prss36 T C 7: 127,934,567 R22G probably benign Het
Slc45a4 G A 15: 73,581,976 A716V probably damaging Het
Slc46a1 T C 11: 78,466,007 probably null Het
Slc6a5 T C 7: 49,959,351 I768T probably benign Het
Slco6c1 C T 1: 97,081,316 probably null Het
Taar2 A T 10: 23,940,976 H138L probably benign Het
Taf2 A C 15: 55,058,901 L330R probably damaging Het
Tgm5 T C 2: 121,070,729 probably null Het
Tmed4 A T 11: 6,274,491 Y56* probably null Het
Tmem156 A T 5: 65,075,621 F135L probably benign Het
Ttll6 T C 11: 96,134,887 S65P probably damaging Het
Ttn C T 2: 76,726,827 G28199R probably damaging Het
Ubn2 T A 6: 38,470,224 probably null Het
Unc80 A T 1: 66,473,260 T110S possibly damaging Het
Vmn2r72 A T 7: 85,737,929 V809E probably damaging Het
Zbtb2 A G 10: 4,368,599 F476L probably damaging Het
Zfp280d T A 9: 72,329,137 L494Q probably damaging Het
Zfp281 T C 1: 136,626,726 S481P probably benign Het
Other mutations in Zbtb24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Zbtb24 APN 10 41451889 missense possibly damaging 0.63
R0485:Zbtb24 UTSW 10 41464536 missense probably damaging 0.96
R0553:Zbtb24 UTSW 10 41451997 missense possibly damaging 0.78
R0662:Zbtb24 UTSW 10 41462279 missense probably damaging 1.00
R0927:Zbtb24 UTSW 10 41451436 missense probably benign 0.43
R1164:Zbtb24 UTSW 10 41464527 missense probably damaging 1.00
R1456:Zbtb24 UTSW 10 41464993 missense possibly damaging 0.46
R1464:Zbtb24 UTSW 10 41455079 missense probably damaging 1.00
R1464:Zbtb24 UTSW 10 41455079 missense probably damaging 1.00
R1873:Zbtb24 UTSW 10 41451127 missense probably benign 0.28
R2299:Zbtb24 UTSW 10 41464581 missense probably damaging 1.00
R2371:Zbtb24 UTSW 10 41451268 missense probably damaging 1.00
R4280:Zbtb24 UTSW 10 41464920 missense probably benign 0.34
R4281:Zbtb24 UTSW 10 41464920 missense probably benign 0.34
R4593:Zbtb24 UTSW 10 41451957 missense possibly damaging 0.89
R4991:Zbtb24 UTSW 10 41456618 splice site probably null
R5262:Zbtb24 UTSW 10 41464560 nonsense probably null
R5371:Zbtb24 UTSW 10 41451541 missense probably benign 0.01
R5393:Zbtb24 UTSW 10 41464582 missense probably damaging 1.00
R5428:Zbtb24 UTSW 10 41464788 missense probably benign
R5785:Zbtb24 UTSW 10 41451853 missense probably benign 0.00
R6033:Zbtb24 UTSW 10 41464401 missense probably damaging 1.00
R6961:Zbtb24 UTSW 10 41455175 missense probably damaging 1.00
R7189:Zbtb24 UTSW 10 41464476 missense probably benign 0.00
R7407:Zbtb24 UTSW 10 41464779 missense possibly damaging 0.94
R8074:Zbtb24 UTSW 10 41451232 missense probably damaging 1.00
Z1176:Zbtb24 UTSW 10 41455190 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAGCACTCAAGGGTCAGGTG -3'
(R):5'- AGAAGCTGAATCTCCTGCTC -3'

Sequencing Primer
(F):5'- GACTGCTTCTGCCTGAGTGAAC -3'
(R):5'- TCTCCCGACGTGGAGAG -3'
Posted On2017-08-16