Incidental Mutation 'R6033:Slc45a4'
ID486414
Institutional Source Beutler Lab
Gene Symbol Slc45a4
Ensembl Gene ENSMUSG00000079020
Gene Namesolute carrier family 45, member 4
Synonyms9330175B01Rik
MMRRC Submission 044205-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6033 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location73577424-73645762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73581976 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 716 (A716V)
Ref Sequence ENSEMBL: ENSMUSP00000121775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054266] [ENSMUST00000076224] [ENSMUST00000132607] [ENSMUST00000151288]
Predicted Effect probably damaging
Transcript: ENSMUST00000054266
AA Change: A724V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054651
Gene: ENSMUSG00000079020
AA Change: A724V

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
low complexity region 213 225 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
low complexity region 488 499 N/A INTRINSIC
low complexity region 501 518 N/A INTRINSIC
transmembrane domain 533 555 N/A INTRINSIC
transmembrane domain 585 604 N/A INTRINSIC
transmembrane domain 617 639 N/A INTRINSIC
transmembrane domain 643 665 N/A INTRINSIC
transmembrane domain 685 707 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
low complexity region 754 770 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000076224
AA Change: A716V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075577
Gene: ENSMUSG00000079020
AA Change: A716V

DomainStartEndE-ValueType
Pfam:MFS_2 52 266 1.6e-9 PFAM
low complexity region 480 491 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
transmembrane domain 577 596 N/A INTRINSIC
transmembrane domain 609 631 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
transmembrane domain 709 731 N/A INTRINSIC
low complexity region 746 762 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132607
AA Change: A522V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115827
Gene: ENSMUSG00000079020
AA Change: A522V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
low complexity region 286 297 N/A INTRINSIC
low complexity region 299 316 N/A INTRINSIC
transmembrane domain 331 353 N/A INTRINSIC
transmembrane domain 383 402 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 483 505 N/A INTRINSIC
transmembrane domain 515 537 N/A INTRINSIC
low complexity region 552 568 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144936
AA Change: A651V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122825
Gene: ENSMUSG00000079020
AA Change: A651V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
low complexity region 141 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
transmembrane domain 461 483 N/A INTRINSIC
transmembrane domain 513 532 N/A INTRINSIC
transmembrane domain 545 567 N/A INTRINSIC
transmembrane domain 571 593 N/A INTRINSIC
transmembrane domain 613 635 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 682 698 N/A INTRINSIC
low complexity region 703 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151288
AA Change: A716V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121775
Gene: ENSMUSG00000079020
AA Change: A716V

DomainStartEndE-ValueType
Pfam:MFS_2 52 266 1.6e-9 PFAM
low complexity region 480 491 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
transmembrane domain 577 596 N/A INTRINSIC
transmembrane domain 609 631 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
transmembrane domain 709 731 N/A INTRINSIC
low complexity region 746 762 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152558
SMART Domains Protein: ENSMUSP00000114790
Gene: ENSMUSG00000079020

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 112 131 N/A INTRINSIC
Meta Mutation Damage Score 0.7693 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,372 E72G probably damaging Het
Adgrl1 T A 8: 83,918,922 V58E probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alas1 A G 9: 106,241,204 S240P probably damaging Het
Alox12e C T 11: 70,316,013 G616D probably benign Het
Arhgap8 A G 15: 84,741,925 E67G probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Ccdc150 G T 1: 54,285,628 probably null Het
Cmtm8 T C 9: 114,796,073 T97A probably damaging Het
Cnmd T C 14: 79,661,505 S36G probably benign Het
Dnah3 A C 7: 120,071,647 N609K probably benign Het
Dph1 C T 11: 75,191,197 probably benign Het
Drosha G A 15: 12,925,999 A1225T probably benign Het
Eid3 T A 10: 82,867,653 I316K probably damaging Het
Erich6 A G 3: 58,623,201 L449S probably benign Het
Fhod1 T C 8: 105,336,434 probably benign Het
Glra1 A G 11: 55,527,419 Y250H probably damaging Het
Gm21972 T C 1: 86,137,095 Y950H probably damaging Het
Gm6712 T A 17: 17,294,416 noncoding transcript Het
Gm6768 A G 12: 119,261,740 noncoding transcript Het
Grb7 C T 11: 98,455,197 probably null Het
Hivep1 A G 13: 42,157,107 E941G probably benign Het
Homer2 A C 7: 81,618,679 S78A possibly damaging Het
Ica1 T A 6: 8,630,799 probably null Het
Ifna12 T C 4: 88,602,917 E131G possibly damaging Het
Igbp1b T C 6: 138,658,209 Y79C probably damaging Het
Incenp C T 19: 9,872,697 V871I probably damaging Het
Jaml G A 9: 45,088,710 G60D probably damaging Het
Kcp C T 6: 29,493,194 C110Y probably damaging Het
Manba T C 3: 135,549,261 V460A probably benign Het
Myrfl A T 10: 116,849,101 C125S probably benign Het
Ncan T C 8: 70,112,590 D229G probably damaging Het
Nlrp10 A T 7: 108,924,577 D565E probably benign Het
Npas2 T C 1: 39,338,180 V541A probably damaging Het
Nsg2 G A 11: 32,055,058 V87M possibly damaging Het
Olfr1040 A T 2: 86,146,269 V155E probably damaging Het
Prkd2 C T 7: 16,865,714 R701C probably damaging Het
Prr3 A T 17: 35,978,624 probably null Het
Prss36 T C 7: 127,934,567 R22G probably benign Het
Slc46a1 T C 11: 78,466,007 probably null Het
Slc6a5 T C 7: 49,959,351 I768T probably benign Het
Slco6c1 C T 1: 97,081,316 probably null Het
Taar2 A T 10: 23,940,976 H138L probably benign Het
Taf2 A C 15: 55,058,901 L330R probably damaging Het
Tgm5 T C 2: 121,070,729 probably null Het
Tmed4 A T 11: 6,274,491 Y56* probably null Het
Tmem156 A T 5: 65,075,621 F135L probably benign Het
Ttll6 T C 11: 96,134,887 S65P probably damaging Het
Ttn C T 2: 76,726,827 G28199R probably damaging Het
Ubn2 T A 6: 38,470,224 probably null Het
Unc80 A T 1: 66,473,260 T110S possibly damaging Het
Vmn2r72 A T 7: 85,737,929 V809E probably damaging Het
Zbtb2 A G 10: 4,368,599 F476L probably damaging Het
Zbtb24 T C 10: 41,464,401 F498L probably damaging Het
Zfp280d T A 9: 72,329,137 L494Q probably damaging Het
Zfp281 T C 1: 136,626,726 S481P probably benign Het
Other mutations in Slc45a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Slc45a4 APN 15 73587655 missense probably damaging 1.00
IGL02506:Slc45a4 APN 15 73581838 missense probably benign 0.00
IGL02642:Slc45a4 APN 15 73586815 missense probably benign
IGL03195:Slc45a4 APN 15 73584423 missense possibly damaging 0.89
Undefined UTSW 15 73584450 missense probably damaging 1.00
R0048:Slc45a4 UTSW 15 73605436 splice site probably benign
R0189:Slc45a4 UTSW 15 73581914 missense probably benign 0.00
R0240:Slc45a4 UTSW 15 73581906 missense probably benign 0.02
R0240:Slc45a4 UTSW 15 73581906 missense probably benign 0.02
R0828:Slc45a4 UTSW 15 73586816 missense probably benign 0.01
R1172:Slc45a4 UTSW 15 73605429 splice site probably benign
R1331:Slc45a4 UTSW 15 73586747 missense probably benign 0.00
R1739:Slc45a4 UTSW 15 73586038 missense probably damaging 1.00
R2310:Slc45a4 UTSW 15 73589560 missense probably damaging 1.00
R4695:Slc45a4 UTSW 15 73582075 missense possibly damaging 0.94
R4904:Slc45a4 UTSW 15 73586842 missense probably benign 0.18
R4974:Slc45a4 UTSW 15 73584450 missense probably damaging 1.00
R6033:Slc45a4 UTSW 15 73581976 missense probably damaging 1.00
R6114:Slc45a4 UTSW 15 73605604 missense probably damaging 0.96
R7057:Slc45a4 UTSW 15 73587638 missense probably damaging 1.00
R7221:Slc45a4 UTSW 15 73586410 missense probably benign 0.06
R7288:Slc45a4 UTSW 15 73586936 nonsense probably null
R7331:Slc45a4 UTSW 15 73605640 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCGAGACAGCTTCAGTACAG -3'
(R):5'- AGAGTGTGTCTTCTCCCTCAGTG -3'

Sequencing Primer
(F):5'- ACAGCTTCAGTACAGTGGGCTTC -3'
(R):5'- TGAGGTACTAATGAAGACCGCCTTC -3'
Posted On2017-08-16