Incidental Mutation 'R6033:Afg3l2'
ID 486417
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene Name AFG3-like AAA ATPase 2
Synonyms 2310036I02Rik, Emv66, par
MMRRC Submission 044205-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6033 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 67404767-67449166 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 67421259 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 458 (L458M)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
AlphaFold Q8JZQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000025408
AA Change: L458M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: L458M

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Meta Mutation Damage Score 0.3865 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,372 E72G probably damaging Het
Adgrl1 T A 8: 83,918,922 V58E probably damaging Het
Alas1 A G 9: 106,241,204 S240P probably damaging Het
Alox12e C T 11: 70,316,013 G616D probably benign Het
Arhgap8 A G 15: 84,741,925 E67G probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Ccdc150 G T 1: 54,285,628 probably null Het
Cmtm8 T C 9: 114,796,073 T97A probably damaging Het
Cnmd T C 14: 79,661,505 S36G probably benign Het
Dnah3 A C 7: 120,071,647 N609K probably benign Het
Dph1 C T 11: 75,191,197 probably benign Het
Drosha G A 15: 12,925,999 A1225T probably benign Het
Eid3 T A 10: 82,867,653 I316K probably damaging Het
Erich6 A G 3: 58,623,201 L449S probably benign Het
Fhod1 T C 8: 105,336,434 probably benign Het
Glra1 A G 11: 55,527,419 Y250H probably damaging Het
Gm21972 T C 1: 86,137,095 Y950H probably damaging Het
Gm6712 T A 17: 17,294,416 noncoding transcript Het
Gm6768 A G 12: 119,261,740 noncoding transcript Het
Grb7 C T 11: 98,455,197 probably null Het
Hivep1 A G 13: 42,157,107 E941G probably benign Het
Homer2 A C 7: 81,618,679 S78A possibly damaging Het
Ica1 T A 6: 8,630,799 probably null Het
Ifna12 T C 4: 88,602,917 E131G possibly damaging Het
Igbp1b T C 6: 138,658,209 Y79C probably damaging Het
Incenp C T 19: 9,872,697 V871I probably damaging Het
Jaml G A 9: 45,088,710 G60D probably damaging Het
Kcp C T 6: 29,493,194 C110Y probably damaging Het
Manba T C 3: 135,549,261 V460A probably benign Het
Myrfl A T 10: 116,849,101 C125S probably benign Het
Ncan T C 8: 70,112,590 D229G probably damaging Het
Nlrp10 A T 7: 108,924,577 D565E probably benign Het
Npas2 T C 1: 39,338,180 V541A probably damaging Het
Nsg2 G A 11: 32,055,058 V87M possibly damaging Het
Olfr1040 A T 2: 86,146,269 V155E probably damaging Het
Prkd2 C T 7: 16,865,714 R701C probably damaging Het
Prr3 A T 17: 35,978,624 probably null Het
Prss36 T C 7: 127,934,567 R22G probably benign Het
Slc45a4 G A 15: 73,581,976 A716V probably damaging Het
Slc46a1 T C 11: 78,466,007 probably null Het
Slc6a5 T C 7: 49,959,351 I768T probably benign Het
Slco6c1 C T 1: 97,081,316 probably null Het
Taar2 A T 10: 23,940,976 H138L probably benign Het
Taf2 A C 15: 55,058,901 L330R probably damaging Het
Tgm5 T C 2: 121,070,729 probably null Het
Tmed4 A T 11: 6,274,491 Y56* probably null Het
Tmem156 A T 5: 65,075,621 F135L probably benign Het
Ttll6 T C 11: 96,134,887 S65P probably damaging Het
Ttn C T 2: 76,726,827 G28199R probably damaging Het
Ubn2 T A 6: 38,470,224 probably null Het
Unc80 A T 1: 66,473,260 T110S possibly damaging Het
Vmn2r72 A T 7: 85,737,929 V809E probably damaging Het
Zbtb2 A G 10: 4,368,599 F476L probably damaging Het
Zbtb24 T C 10: 41,464,401 F498L probably damaging Het
Zfp280d T A 9: 72,329,137 L494Q probably damaging Het
Zfp281 T C 1: 136,626,726 S481P probably benign Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67431653 critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67442810 missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67405418 nonsense probably null
IGL01814:Afg3l2 APN 18 67405474 missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67414148 missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67429040 missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67425945 missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67407320 missense probably benign
IGL03392:Afg3l2 APN 18 67414069 splice site probably benign
radicle UTSW 18 67422953 missense probably damaging 1.00
rootlet UTSW 18 67421259 missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67423086 missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67431766 missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67415557 missense possibly damaging 0.77
R0831:Afg3l2 UTSW 18 67421227 missense probably damaging 1.00
R0899:Afg3l2 UTSW 18 67422977 missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67405427 missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67407423 missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67415573 nonsense probably null
R1838:Afg3l2 UTSW 18 67414172 missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67431772 missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67422956 missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67440222 missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4765:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5196:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5361:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67440207 missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67442355 nonsense probably null
R5696:Afg3l2 UTSW 18 67407459 missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67440199 missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67440443 missense probably null 0.12
R5972:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5973:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67429070 missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6075:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6081:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6154:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6169:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67409528 missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67421276 missense probably damaging 1.00
R7388:Afg3l2 UTSW 18 67422953 missense probably damaging 1.00
R8479:Afg3l2 UTSW 18 67448916 missense probably benign 0.05
R8531:Afg3l2 UTSW 18 67407369 missense probably damaging 0.99
R9017:Afg3l2 UTSW 18 67409480 missense possibly damaging 0.81
R9220:Afg3l2 UTSW 18 67429196 missense probably benign
R9222:Afg3l2 UTSW 18 67434187 missense probably benign 0.05
R9371:Afg3l2 UTSW 18 67434192 missense possibly damaging 0.84
R9381:Afg3l2 UTSW 18 67442381 missense probably damaging 1.00
R9562:Afg3l2 UTSW 18 67421295 missense probably damaging 1.00
Z1176:Afg3l2 UTSW 18 67431707 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GCACTGTCCAGCTTCAATGG -3'
(R):5'- AGTTTACATCTTGATTGTAGCTCCC -3'

Sequencing Primer
(F):5'- TCCAGCTTCAATGGTCGAAG -3'
(R):5'- GATTGTAGCTCCCCTCTCCAG -3'
Posted On 2017-08-16