Incidental Mutation 'R6034:Imp4'
ID486419
Institutional Source Beutler Lab
Gene Symbol Imp4
Ensembl Gene ENSMUSG00000026127
Gene NameIMP4, U3 small nucleolar ribonucleoprotein
Synonyms
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R6034 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location34439851-34449356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34443456 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 91 (D91G)
Ref Sequence ENSEMBL: ENSMUSP00000120823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027303] [ENSMUST00000042493] [ENSMUST00000136770] [ENSMUST00000137794] [ENSMUST00000149962]
Predicted Effect probably damaging
Transcript: ENSMUST00000027303
AA Change: D92G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027303
Gene: ENSMUSG00000026127
AA Change: D92G

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Blast:Brix 22 71 3e-13 BLAST
Brix 86 258 2.37e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042493
SMART Domains Protein: ENSMUSP00000042918
Gene: ENSMUSG00000042111

DomainStartEndE-ValueType
coiled coil region 3 38 N/A INTRINSIC
coiled coil region 154 175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134327
Predicted Effect probably damaging
Transcript: ENSMUST00000136770
AA Change: D91G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120823
Gene: ENSMUSG00000026127
AA Change: D91G

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
Blast:Brix 25 70 3e-14 BLAST
Pfam:Brix 86 147 3.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137794
SMART Domains Protein: ENSMUSP00000121452
Gene: ENSMUSG00000026127

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Blast:Brix 26 91 4e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149962
SMART Domains Protein: ENSMUSP00000141982
Gene: ENSMUSG00000026127

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Blast:Brix 26 91 4e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191315
Meta Mutation Damage Score 0.4928 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, along with IMP3 and MPP10, is part of the 60-80S U3 small nucleolar ribonucleoprotein (U3 snoRNP) complex. This complex is necessary for the early cleavage steps of pre-18S ribosomal RNA processing. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
Gapdh T C 6: 125,165,298 D25G probably benign Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Imp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01948:Imp4 APN 1 34444275 splice site probably benign
IGL02039:Imp4 APN 1 34443768 critical splice acceptor site probably null
IGL02483:Imp4 APN 1 34444275 splice site probably null
IGL02799:Imp4 UTSW 1 34440177 intron probably benign
R2265:Imp4 UTSW 1 34443847 missense probably damaging 1.00
R5038:Imp4 UTSW 1 34442935 missense probably damaging 1.00
R6034:Imp4 UTSW 1 34443456 missense probably damaging 1.00
R6145:Imp4 UTSW 1 34440096 missense probably benign 0.06
R6696:Imp4 UTSW 1 34444246 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CACAGTAGCTTTTAGTCTTTGCTCG -3'
(R):5'- TAGTGCTCCAACCTCATGCC -3'

Sequencing Primer
(F):5'- CAGAAGTGTCCTTAGCACTGGTAC -3'
(R):5'- ACCTCATGCCGACCTCG -3'
Posted On2017-08-16