Incidental Mutation 'R6034:Cps1'
ID486422
Institutional Source Beutler Lab
Gene Symbol Cps1
Ensembl Gene ENSMUSG00000025991
Gene Namecarbamoyl-phosphate synthetase 1
SynonymsCPSase I, D1Ucla3, CPS, 4732433M03Rik
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6034 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location67123026-67231259 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 67157713 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027144]
Predicted Effect probably null
Transcript: ENSMUST00000027144
SMART Domains Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991

DomainStartEndE-ValueType
CPSase_sm_chain 44 184 2.5e-70 SMART
Pfam:GATase 221 397 1.5e-40 PFAM
low complexity region 426 436 N/A INTRINSIC
Pfam:ATP-grasp_4 543 724 6.8e-12 PFAM
Pfam:CPSase_L_D2 546 750 1.7e-85 PFAM
Pfam:ATP-grasp 554 722 4.9e-8 PFAM
Pfam:Dala_Dala_lig_C 561 718 1.5e-7 PFAM
CPSase_L_D3 839 962 1.18e-57 SMART
Pfam:ATP-grasp_4 1085 1264 1e-19 PFAM
Pfam:CPSase_L_D2 1088 1291 7.4e-32 PFAM
Pfam:Dala_Dala_lig_C 1095 1279 1.6e-6 PFAM
Pfam:ATP-grasp 1096 1263 2.8e-12 PFAM
MGS 1373 1465 1.53e-15 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
Gapdh T C 6: 125,165,298 D25G probably benign Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Cps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Cps1 APN 1 67152380 splice site probably benign
IGL00897:Cps1 APN 1 67215564 missense probably benign 0.08
IGL00928:Cps1 APN 1 67123234 missense probably benign
IGL01063:Cps1 APN 1 67195166 missense possibly damaging 0.91
IGL01081:Cps1 APN 1 67206824 missense probably damaging 1.00
IGL01361:Cps1 APN 1 67195145 missense probably benign 0.03
IGL01396:Cps1 APN 1 67157786 missense probably damaging 1.00
IGL01516:Cps1 APN 1 67230284 missense probably damaging 0.99
IGL01695:Cps1 APN 1 67197035 missense probably benign
IGL02022:Cps1 APN 1 67172872 splice site probably benign
IGL02032:Cps1 APN 1 67230315 missense probably benign 0.03
IGL02049:Cps1 APN 1 67143954 missense possibly damaging 0.68
IGL02197:Cps1 APN 1 67157764 missense probably benign
IGL02217:Cps1 APN 1 67174382 missense probably benign 0.06
IGL02555:Cps1 APN 1 67214021 missense probably benign 0.06
IGL02570:Cps1 APN 1 67148703 splice site probably benign
IGL02633:Cps1 APN 1 67123237 missense probably benign
IGL02711:Cps1 APN 1 67212517 splice site probably benign
IGL02737:Cps1 APN 1 67148774 missense probably benign 0.35
IGL03030:Cps1 APN 1 67142921 missense probably damaging 1.00
IGL03255:Cps1 APN 1 67145801 nonsense probably null
Madman UTSW 1 67160871 missense probably damaging 0.96
maniac UTSW 1 67157878 critical splice donor site probably null
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0140:Cps1 UTSW 1 67180116 missense probably benign
R0318:Cps1 UTSW 1 67177014 missense probably damaging 0.99
R0486:Cps1 UTSW 1 67165392 missense probably damaging 1.00
R0488:Cps1 UTSW 1 67148808 splice site probably benign
R0492:Cps1 UTSW 1 67157836 missense probably damaging 1.00
R0521:Cps1 UTSW 1 67215564 missense probably benign 0.02
R0534:Cps1 UTSW 1 67143900 missense probably benign 0.06
R0565:Cps1 UTSW 1 67166449 missense possibly damaging 0.57
R0609:Cps1 UTSW 1 67172802 missense probably damaging 1.00
R0612:Cps1 UTSW 1 67139770 missense probably benign 0.01
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1220:Cps1 UTSW 1 67204703 critical splice donor site probably null
R1321:Cps1 UTSW 1 67143019 splice site probably benign
R1343:Cps1 UTSW 1 67209609 missense probably damaging 1.00
R1373:Cps1 UTSW 1 67229424 missense possibly damaging 0.89
R1374:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1481:Cps1 UTSW 1 67143882 missense probably damaging 0.99
R1711:Cps1 UTSW 1 67168374 splice site probably null
R1712:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1774:Cps1 UTSW 1 67170882 missense possibly damaging 0.94
R1799:Cps1 UTSW 1 67209642 missense probably damaging 1.00
R1954:Cps1 UTSW 1 67195196 missense possibly damaging 0.71
R2074:Cps1 UTSW 1 67204638 missense probably benign 0.21
R2078:Cps1 UTSW 1 67195265 missense possibly damaging 0.74
R2078:Cps1 UTSW 1 67157806 missense probably damaging 1.00
R2111:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2112:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2146:Cps1 UTSW 1 67152379 splice site probably benign
R2355:Cps1 UTSW 1 67156224 missense probably damaging 1.00
R2375:Cps1 UTSW 1 67217860 missense probably benign 0.00
R2860:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2861:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2979:Cps1 UTSW 1 67204704 critical splice donor site probably null
R3427:Cps1 UTSW 1 67174494 missense probably damaging 1.00
R3833:Cps1 UTSW 1 67139787 missense probably damaging 1.00
R3857:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3858:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3859:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3886:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3887:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3888:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3889:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R4386:Cps1 UTSW 1 67170995 critical splice donor site probably null
R4497:Cps1 UTSW 1 67205199 missense probably null 1.00
R4671:Cps1 UTSW 1 67196560 missense probably damaging 1.00
R4774:Cps1 UTSW 1 67220512 missense probably damaging 0.99
R4799:Cps1 UTSW 1 67142986 missense probably damaging 0.96
R4853:Cps1 UTSW 1 67156202 missense possibly damaging 0.51
R4884:Cps1 UTSW 1 67177024 missense probably benign 0.11
R4900:Cps1 UTSW 1 67160904 missense probably damaging 1.00
R4906:Cps1 UTSW 1 67139763 missense probably benign 0.10
R5091:Cps1 UTSW 1 67229520 critical splice donor site probably null
R5102:Cps1 UTSW 1 67206793 missense probably benign 0.00
R5215:Cps1 UTSW 1 67166380 missense possibly damaging 0.62
R5290:Cps1 UTSW 1 67172709 missense probably benign 0.21
R5732:Cps1 UTSW 1 67157764 missense probably benign 0.22
R5818:Cps1 UTSW 1 67166488 missense possibly damaging 0.96
R5878:Cps1 UTSW 1 67157878 critical splice donor site probably null
R6002:Cps1 UTSW 1 67172755 missense possibly damaging 0.94
R6034:Cps1 UTSW 1 67157713 intron probably null
R6199:Cps1 UTSW 1 67162615 frame shift probably null
R6310:Cps1 UTSW 1 67142981 missense probably benign 0.00
R6554:Cps1 UTSW 1 67174469 nonsense probably null
R6700:Cps1 UTSW 1 67229523 splice site probably null
R6731:Cps1 UTSW 1 67160871 missense probably damaging 0.96
R7052:Cps1 UTSW 1 67198410 missense probably damaging 1.00
R7278:Cps1 UTSW 1 67170921 missense probably damaging 1.00
R7313:Cps1 UTSW 1 67198358 missense probably damaging 0.99
R7323:Cps1 UTSW 1 67157869 missense probably benign 0.03
R7339:Cps1 UTSW 1 67197015 missense possibly damaging 0.64
R7485:Cps1 UTSW 1 67139857 missense probably damaging 1.00
R7505:Cps1 UTSW 1 67180081 missense probably benign
R7748:Cps1 UTSW 1 67139806 missense probably damaging 1.00
R7853:Cps1 UTSW 1 67174481 missense possibly damaging 0.92
R7936:Cps1 UTSW 1 67174481 missense possibly damaging 0.92
X0024:Cps1 UTSW 1 67123247 missense probably benign
Z1176:Cps1 UTSW 1 67123268 missense possibly damaging 0.54
Z1176:Cps1 UTSW 1 67148719 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCAATTCCTTTTGTTATGAGTGCC -3'
(R):5'- AGGATTGTTGAGAGCATTTACCTC -3'

Sequencing Primer
(F):5'- GAGTGCCTTTCTAAAACTGATTGTAG -3'
(R):5'- AGAGCATTTACCTCGTTTGTTTGATC -3'
Posted On2017-08-16