Mutagenetix > Incidental Mutations

Incidental Mutation 'R6035:Fmo3'

486477

Institutional Source

Beutler Lab

Gene Symbol

Fmo3

Ensembl Gene

ENSMUSG00000026691

Gene Name

flavin containing monooxygenase 3

Synonyms

MMRRC Submission

044207-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6035 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

162953800-162984528 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 162964036 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 224 (V224G)

Ref Sequence

ENSEMBL: ENSMUSP00000028010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028010]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028010
AA Change: V224G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000028010
Gene: ENSMUSG00000026691
AA Change: V224G

Domain	Start	End	E-Value	Type
Pfam:FMO-like	2	534	7.7e-286	PFAM
Pfam:Pyr_redox_2	3	245	4.4e-15	PFAM
Pfam:Pyr_redox_3	6	220	1.1e-11	PFAM
Pfam:NAD_binding_8	7	71	3.1e-7	PFAM
Pfam:K_oxygenase	79	224	6.7e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142759

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

84% (62/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Flavin-containing monooxygenases (FMO) are an important class of drug-metabolizing enzymes that catalyze the NADPH-dependent oxygenation of various nitrogen-,sulfur-, and phosphorous-containing xenobiotics such as therapeutic drugs, dietary compounds, pesticides, and other foreign compounds. The human FMO gene family is composed of 5 genes and multiple pseudogenes. FMO members have distinct developmental- and tissue-specific expression patterns. The expression of this FMO3 gene, the major FMO expressed in adult liver, can vary up to 20-fold between individuals. This inter-individual variation in FMO3 expression levels is likely to have significant effects on the rate at which xenobiotics are metabolised and, therefore, is of considerable interest to the pharmaceutical industry. This transmembrane protein localizes to the endoplasmic reticulum of many tissues. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Mutations in this gene cause the disorder trimethylaminuria (TMAu) which is characterized by the accumulation and excretion of unmetabolized trimethylamine and a distinctive body odor. In healthy individuals, trimethylamine is primarily converted to the non odorous trimethylamine N-oxide.[provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	G	T	6: 121,638,394	G76W	probably damaging	Het
Abca17	A	T	17: 24,281,245	F1324Y	possibly damaging	Het
Abca8b	A	T	11: 109,971,860		probably null	Het
Abcc12	A	G	8: 86,517,404	M1040T	probably damaging	Het
Abtb1	A	G	6: 88,841,806	F7L	probably damaging	Het
Adcy9	T	C	16: 4,304,513	T558A	probably benign	Het
Adgrb1	A	T	15: 74,540,443	T424S	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ankrd31	C	A	13: 96,832,213	P786Q	probably benign	Het
Arhgap39	G	T	15: 76,737,224	Y392*	probably null	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Carmil2	G	T	8: 105,692,563	W749L	probably benign	Het
Ccar1	A	G	10: 62,751,785	Y867H	unknown	Het
Cdh13	A	G	8: 118,505,698	D47G	probably benign	Het
Chst9	T	A	18: 15,452,853	T218S	probably benign	Het
Clec2i	G	A	6: 128,893,624	V67I	probably benign	Het
Cox7a2	T	A	9: 79,759,746		probably benign	Het
Cpz	A	G	5: 35,517,585	C107R	probably damaging	Het
Dapk1	T	A	13: 60,761,199	C1209S	possibly damaging	Het
Ddx41	T	C	13: 55,533,968	M307V	probably benign	Het
Defa24	A	G	8: 21,734,549	I5V	probably benign	Het
Dgcr8	A	T	16: 18,258,314	N2K	probably damaging	Het
Ebf2	A	G	14: 67,238,974	D131G	probably damaging	Het
Fam149b	C	T	14: 20,377,917	R424C	probably damaging	Het
Fbln2	G	A	6: 91,263,353	V714M	probably damaging	Het
Fgf5	T	C	5: 98,275,526	Y257H	probably damaging	Het
Gigyf2	T	C	1: 87,410,728	I394T	possibly damaging	Het
Glmn	T	A	5: 107,593,880		probably null	Het
Greb1l	T	C	18: 10,501,025	I385T	possibly damaging	Het
Grhl1	C	A	12: 24,608,450	Q365K	probably benign	Het
Gsdme	G	A	6: 50,229,326	T179M	probably damaging	Het
Gtf2a1l	A	G	17: 88,711,534	T349A	probably benign	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,997,940		probably benign	Het
Il5ra	G	A	6: 106,741,265	T76I	probably damaging	Het
Itga8	T	C	2: 12,191,714	T631A	probably benign	Het
Kcnh6	G	A	11: 106,019,152		probably null	Het
Krt26	C	T	11: 99,333,589	E368K	probably benign	Het
Lhx9	T	C	1: 138,838,543	D169G	possibly damaging	Het
Lman1l	A	G	9: 57,611,747		probably null	Het
Lmod3	A	G	6: 97,247,273	L529P	probably damaging	Het
Nup155	A	G	15: 8,144,093	T891A	probably benign	Het
Olfr20	T	C	11: 73,353,756	M1T	probably null	Het
Olfr341	T	A	2: 36,479,984	I49F	probably damaging	Het
Olfr409-ps1	T	C	11: 74,317,459	*145R	probably null	Het
Olfr739	A	G	14: 50,424,527	T3A	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Papln	G	C	12: 83,774,680	G262A	probably damaging	Het
Pdcd1lg2	G	A	19: 29,446,035	V160I	probably benign	Het
Pde8b	A	G	13: 95,027,597		probably benign	Het
Ppme1	G	A	7: 100,354,795	R68*	probably null	Het
Prob1	T	C	18: 35,654,782	S140G	probably benign	Het
Ptprn2	A	T	12: 117,255,595	N949Y	probably damaging	Het
Qser1	C	A	2: 104,787,123	D1115Y	probably damaging	Het
Rad54l	G	T	4: 116,097,469	D674E	probably damaging	Het
Ripk4	T	A	16: 97,744,187	D420V	probably damaging	Het
Ros1	G	T	10: 52,077,971	S1857R	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Homo
Rsf1	A	G	7: 97,662,109	E682G	probably benign	Het
Samd4	G	A	14: 47,087,872	R515H	probably damaging	Het
Selp	T	A	1: 164,141,510	W560R	probably benign	Het
Shc3	A	T	13: 51,461,432	L163Q	probably damaging	Het
Shh	G	A	5: 28,461,399	A163V	probably damaging	Het
Slc17a8	T	C	10: 89,592,075	R113G	possibly damaging	Het
Slc5a6	C	A	5: 31,048,824		probably benign	Het
Smarcd2	A	G	11: 106,266,889		probably null	Het
Sytl3	A	G	17: 6,728,265	D148G	probably damaging	Het
Tnks	G	T	8: 34,918,461	H297Q	possibly damaging	Het
Trbv21	A	T	6: 41,202,634		probably benign	Het
Ube3c	T	C	5: 29,601,163	F268L	probably benign	Het
Ugt2b5	T	C	5: 87,139,682	I209V	probably benign	Het
Usp1	A	G	4: 98,929,845	N140S	probably damaging	Het
Vcam1	T	C	3: 116,125,957	Y226C	probably damaging	Het
Vmn1r129	T	A	7: 21,360,609	Q228L	probably damaging	Het
Vmn1r209	T	A	13: 22,806,032	N163Y	probably benign	Het
Vmn1r85	A	G	7: 13,084,927	S97P	probably damaging	Het
Vmn2r30	C	T	7: 7,334,351	M95I	probably benign	Het
Vmn2r74	G	A	7: 85,951,890	R847C	probably damaging	Het
Wdr70	G	A	15: 7,887,349	T529I	possibly damaging	Het
Zfp532	T	G	18: 65,623,934	S313A	possibly damaging	Het
Zhx3	A	T	2: 160,779,543	N901K	probably benign	Het

Other mutations in Fmo3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00975:Fmo3	APN	1	162964030	missense	probably benign	0.15
IGL01124:Fmo3	APN	1	162958261	missense	probably damaging	1.00
IGL01645:Fmo3	APN	1	162964006	missense	possibly damaging	0.53
IGL01710:Fmo3	APN	1	162983043	missense	probably damaging	1.00
IGL01943:Fmo3	APN	1	162967006	missense	probably benign	0.01
IGL02489:Fmo3	APN	1	162954287	missense	possibly damaging	0.75
IGL02503:Fmo3	APN	1	162968864	missense	probably benign	0.03
IGL02743:Fmo3	APN	1	162958483	missense	probably damaging	1.00
IGL02974:Fmo3	APN	1	162983050	missense	probably damaging	1.00
IGL03023:Fmo3	APN	1	162958465	missense	probably benign	0.00
R0554:Fmo3	UTSW	1	162954332	missense	probably benign	0.03
R0629:Fmo3	UTSW	1	162958227	splice site	probably benign
R1209:Fmo3	UTSW	1	162964028	missense	probably benign	0.00
R1213:Fmo3	UTSW	1	162967823	missense	probably damaging	1.00
R1612:Fmo3	UTSW	1	162967885	missense	probably damaging	1.00
R1636:Fmo3	UTSW	1	162954425	missense	probably benign
R1710:Fmo3	UTSW	1	162967787	missense	possibly damaging	0.59
R1764:Fmo3	UTSW	1	162958573	missense	possibly damaging	0.79
R1775:Fmo3	UTSW	1	162968725	missense	possibly damaging	0.54
R1906:Fmo3	UTSW	1	162966906	missense	probably damaging	1.00
R2363:Fmo3	UTSW	1	162954315	missense	probably damaging	0.98
R2418:Fmo3	UTSW	1	162966958	missense	probably benign
R2519:Fmo3	UTSW	1	162958305	missense	probably damaging	1.00
R3940:Fmo3	UTSW	1	162963986	missense	probably benign	0.01
R3977:Fmo3	UTSW	1	162958578	missense	probably damaging	0.99
R4779:Fmo3	UTSW	1	162968838	missense	probably damaging	1.00
R4846:Fmo3	UTSW	1	162954311	missense	possibly damaging	0.94
R4892:Fmo3	UTSW	1	162968731	missense	probably benign	0.00
R5102:Fmo3	UTSW	1	162963977	missense	probably benign	0.01
R5516:Fmo3	UTSW	1	162954426	nonsense	probably null
R6035:Fmo3	UTSW	1	162964036	missense	probably damaging	0.97
R7050:Fmo3	UTSW	1	162963904	missense	probably damaging	0.98
R7088:Fmo3	UTSW	1	162968865	missense	probably benign	0.04
R7205:Fmo3	UTSW	1	162954288	missense	possibly damaging	0.90
R7371:Fmo3	UTSW	1	162954227	missense	possibly damaging	0.57
R7685:Fmo3	UTSW	1	162958332	missense	possibly damaging	0.73
R8458:Fmo3	UTSW	1	162966940	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GGCCCATCACGTTTTAGTCC -3'
(R):5'- CAAGGGATTTCTACTTCCTCCTGG -3'

Sequencing Primer
(F):5'- AGTCCCTGTTACCTGTTTAAAGG -3'
(R):5'- GATTTCTACTTCCTCCTGGCAAAAAC -3'

Posted On

2017-08-16