Mutagenetix > Incidental Mutation

Incidental Mutation 'R0522:Lrriq1'

48648

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

MMRRC Submission

038715-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R0522 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 103161777 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Histidine at position 1326 (N1326H)

Ref Sequence

ENSEMBL: ENSMUSP00000131419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166240]

AlphaFold

Q0P5X1

Predicted Effect

probably damaging
Transcript: ENSMUST00000166240
AA Change: N1326H

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: N1326H

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.8%

Validation Efficiency

100% (67/67)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130409I23Rik	A	C	1: 181,059,747	D299A	probably damaging	Het
Adgre5	A	G	8: 83,730,176	I192T	probably benign	Het
Adgrl3	T	C	5: 81,726,801	Y982H	possibly damaging	Het
Adgrv1	T	A	13: 81,528,442		probably benign	Het
Alms1	T	C	6: 85,621,615	V1610A	probably benign	Het
Ankrd24	T	C	10: 81,636,355		probably benign	Het
C2cd3	A	G	7: 100,395,222	N337S	probably benign	Het
Cdc40	T	C	10: 40,857,612	Y114C	probably benign	Het
Cdhr1	A	T	14: 37,094,000		probably null	Het
Cfc1	G	A	1: 34,537,153	C98Y	probably damaging	Het
Cyp11b2	A	T	15: 74,851,684		probably benign	Het
Cyth4	C	A	15: 78,615,785	H255Q	possibly damaging	Het
Dip2a	T	C	10: 76,321,531	K80R	probably benign	Het
Dnajb5	G	T	4: 42,957,083	D257Y	probably damaging	Het
Dynll1	T	C	5: 115,300,506		probably benign	Het
Edn1	T	A	13: 42,304,954	V81E	probably damaging	Het
F5	T	C	1: 164,211,763	S1981P	probably damaging	Het
Fam186b	T	A	15: 99,280,519	M309L	probably benign	Het
Gm14221	G	A	2: 160,574,677		noncoding transcript	Het
Gnptab	T	A	10: 88,431,466		probably benign	Het
Golgb1	AAGAGAGAGAGAGAGA	AAGAGAGAGAGAGA	16: 36,915,205		probably null	Het
Gpr176	A	G	2: 118,284,012	C106R	probably damaging	Het
Hdac7	A	T	15: 97,806,679		probably null	Het
Hlx	T	C	1: 184,731,640	S168G	probably damaging	Het
Hnf1a	G	T	5: 114,950,688		probably benign	Het
Hp1bp3	C	T	4: 138,222,161	L19F	possibly damaging	Het
Hspa14	T	A	2: 3,511,049	T63S	probably damaging	Het
Insrr	C	T	3: 87,800,872	S207F	probably damaging	Het
Jak3	C	A	8: 71,682,274		probably benign	Het
Jmjd7	G	A	2: 120,030,341	A91T	probably damaging	Het
Lgals9	G	T	11: 78,965,812	H265Q	possibly damaging	Het
Mdn1	C	A	4: 32,672,837	Q486K	probably benign	Het
Mpeg1	A	G	19: 12,461,759	T194A	probably damaging	Het
Nek5	T	A	8: 22,088,797		probably benign	Het
Pcgf2	A	C	11: 97,692,047	I135M	probably benign	Het
Phactr1	G	T	13: 43,059,591	A222S	probably benign	Het
Pla2r1	T	C	2: 60,479,515	S575G	probably benign	Het
Plcg2	T	C	8: 117,614,288		probably null	Het
Pold3	A	G	7: 100,121,383	V14A	probably damaging	Het
Polg	A	G	7: 79,460,151		probably benign	Het
Poteg	T	G	8: 27,449,958	L48V	possibly damaging	Het
Prmt1	A	T	7: 44,981,779	C50S	probably benign	Het
Prx	T	A	7: 27,518,195	V707E	probably damaging	Het
Rrp12	C	T	19: 41,874,705		probably benign	Het
Saxo1	A	T	4: 86,445,103	V381E	probably damaging	Het
Sh2d2a	T	C	3: 87,847,109		probably null	Het
Slc26a5	A	C	5: 21,846,345	I57R	probably damaging	Het
Slc38a3	T	A	9: 107,655,213		probably null	Het
Slc5a4b	T	C	10: 76,090,700	T188A	probably damaging	Het
Slc7a13	A	G	4: 19,824,010	I260V	probably benign	Het
Smg8	A	T	11: 87,086,462	S98T	probably benign	Het
Spg20	T	A	3: 55,128,365	S548R	probably damaging	Het
Sult6b1	C	T	17: 78,905,529	G98S	probably damaging	Het
Tbc1d2	A	G	4: 46,649,806	Y77H	probably damaging	Het
Tet2	T	A	3: 133,466,804	D1899V	probably damaging	Het
Tmcc1	C	CAT	6: 116,042,870		probably null	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trp53bp1	C	A	2: 121,251,868	A317S	probably null	Het
Uap1l1	T	C	2: 25,363,277	E382G	probably damaging	Het
Ugt1a10	C	T	1: 88,218,249	P473L	probably damaging	Het
Ugt1a9	T	C	1: 88,071,392	V188A	probably damaging	Het
Virma	T	C	4: 11,519,416		probably null	Het
Xrcc6	T	C	15: 82,022,592		probably benign	Het
Zfp719	A	G	7: 43,589,253		probably null	Het
Zfp804b	T	A	5: 6,772,014	T350S	probably benign	Het
Zfp959	G	T	17: 55,896,201	R61M	probably null	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103214824	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1830:Lrriq1	UTSW	10	103161759	missense	probably benign
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4663:Lrriq1	UTSW	10	103063412	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103170466	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	103161752	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103173375	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	103071116	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103223750	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103215954	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103215817	missense	probably damaging	0.99
R7910:Lrriq1	UTSW	10	103215194	nonsense	probably null
R8131:Lrriq1	UTSW	10	103215711	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	103156335	critical splice donor site	probably null
R8211:Lrriq1	UTSW	10	103170547	missense	probably damaging	1.00
R8304:Lrriq1	UTSW	10	103234068	missense	possibly damaging	0.57
R8487:Lrriq1	UTSW	10	103215053	missense	probably damaging	0.98
R8500:Lrriq1	UTSW	10	103046155	missense
R9013:Lrriq1	UTSW	10	103215070	missense	probably damaging	1.00
R9099:Lrriq1	UTSW	10	103216003	missense	probably damaging	0.98
R9155:Lrriq1	UTSW	10	103214779	missense	probably benign	0.03
R9320:Lrriq1	UTSW	10	103221283	missense	probably benign
R9384:Lrriq1	UTSW	10	103170597	missense	probably benign	0.00
R9469:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R9585:Lrriq1	UTSW	10	103215389	missense	probably benign
R9706:Lrriq1	UTSW	10	103046041	missense
R9780:Lrriq1	UTSW	10	103189963	missense	probably damaging	1.00
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202359	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202360	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103234085	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCAGCCTGTAAATCCAAGCAAGTG -3'
(R):5'- ttccctgagtgtagtttcCCTGTGA -3'

Sequencing Primer
(F):5'- TCCAAGCAAGTGTGAAATAAACTC -3'
(R):5'- agtttcCCTGTGATATATAGAACACC -3'

Posted On

2013-06-12