Mutagenetix > Incidental Mutation

Incidental Mutation 'R6035:Tnks'

486511

Institutional Source

Beutler Lab

Gene Symbol

Tnks

Ensembl Gene

ENSMUSG00000031529

Gene Name

tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Synonyms

mTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1

MMRRC Submission

044207-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6035 (G1)

Quality Score

174.009

Status

Validated

Chromosome

Chromosomal Location

34826460-34965690 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 34918461 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 297 (H297Q)

Ref Sequence

ENSEMBL: ENSMUSP00000033929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033929]

AlphaFold

Q6PFX9

PDB Structure

Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033929
AA Change: H297Q

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: H297Q

Domain	Start	End	E-Value	Type
low complexity region	8	17	N/A	INTRINSIC
low complexity region	20	55	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
low complexity region	91	175	N/A	INTRINSIC
ANK	208	237	4.26e-4	SMART
ANK	241	270	3.23e-4	SMART
ANK	274	303	3.28e-5	SMART
ANK	327	355	2.66e3	SMART
ANK	361	390	7.64e-6	SMART
ANK	394	423	2.62e-4	SMART
ANK	427	456	1.99e-4	SMART
ANK	514	546	3.18e-3	SMART
ANK	550	579	1.51e-4	SMART
ANK	583	612	4.26e-4	SMART
ANK	642	670	2.21e3	SMART
ANK	676	705	4.03e-5	SMART
ANK	709	738	2.48e-5	SMART
ANK	742	771	1.64e-5	SMART
low complexity region	792	810	N/A	INTRINSIC
ANK	829	858	1.47e-7	SMART
ANK	862	891	2.21e-2	SMART
ANK	895	924	3.13e-2	SMART
low complexity region	996	1010	N/A	INTRINSIC
SAM	1017	1082	1.14e-12	SMART
Pfam:PARP	1098	1303	1.5e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211065

Meta Mutation Damage Score

0.2037

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

84% (62/74)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	G	T	6: 121,638,394	G76W	probably damaging	Het
Abca17	A	T	17: 24,281,245	F1324Y	possibly damaging	Het
Abca8b	A	T	11: 109,971,860		probably null	Het
Abcc12	A	G	8: 86,517,404	M1040T	probably damaging	Het
Abtb1	A	G	6: 88,841,806	F7L	probably damaging	Het
Adcy9	T	C	16: 4,304,513	T558A	probably benign	Het
Adgrb1	A	T	15: 74,540,443	T424S	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ankrd31	C	A	13: 96,832,213	P786Q	probably benign	Het
Arhgap39	G	T	15: 76,737,224	Y392*	probably null	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Carmil2	G	T	8: 105,692,563	W749L	probably benign	Het
Ccar1	A	G	10: 62,751,785	Y867H	unknown	Het
Cdh13	A	G	8: 118,505,698	D47G	probably benign	Het
Chst9	T	A	18: 15,452,853	T218S	probably benign	Het
Clec2i	G	A	6: 128,893,624	V67I	probably benign	Het
Cox7a2	T	A	9: 79,759,746		probably benign	Het
Cpz	A	G	5: 35,517,585	C107R	probably damaging	Het
Dapk1	T	A	13: 60,761,199	C1209S	possibly damaging	Het
Ddx41	T	C	13: 55,533,968	M307V	probably benign	Het
Defa24	A	G	8: 21,734,549	I5V	probably benign	Het
Dgcr8	A	T	16: 18,258,314	N2K	probably damaging	Het
Ebf2	A	G	14: 67,238,974	D131G	probably damaging	Het
Fam149b	C	T	14: 20,377,917	R424C	probably damaging	Het
Fbln2	G	A	6: 91,263,353	V714M	probably damaging	Het
Fgf5	T	C	5: 98,275,526	Y257H	probably damaging	Het
Fmo3	A	C	1: 162,964,036	V224G	probably damaging	Het
Gigyf2	T	C	1: 87,410,728	I394T	possibly damaging	Het
Glmn	T	A	5: 107,593,880		probably null	Het
Greb1l	T	C	18: 10,501,025	I385T	possibly damaging	Het
Grhl1	C	A	12: 24,608,450	Q365K	probably benign	Het
Gsdme	G	A	6: 50,229,326	T179M	probably damaging	Het
Gtf2a1l	A	G	17: 88,711,534	T349A	probably benign	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,997,940		probably benign	Het
Il5ra	G	A	6: 106,741,265	T76I	probably damaging	Het
Itga8	T	C	2: 12,191,714	T631A	probably benign	Het
Kcnh6	G	A	11: 106,019,152		probably null	Het
Krt26	C	T	11: 99,333,589	E368K	probably benign	Het
Lhx9	T	C	1: 138,838,543	D169G	possibly damaging	Het
Lman1l	A	G	9: 57,611,747		probably null	Het
Lmod3	A	G	6: 97,247,273	L529P	probably damaging	Het
Nup155	A	G	15: 8,144,093	T891A	probably benign	Het
Olfr20	T	C	11: 73,353,756	M1T	probably null	Het
Olfr341	T	A	2: 36,479,984	I49F	probably damaging	Het
Olfr409-ps1	T	C	11: 74,317,459	*145R	probably null	Het
Olfr739	A	G	14: 50,424,527	T3A	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Papln	G	C	12: 83,774,680	G262A	probably damaging	Het
Pdcd1lg2	G	A	19: 29,446,035	V160I	probably benign	Het
Pde8b	A	G	13: 95,027,597		probably benign	Het
Ppme1	G	A	7: 100,354,795	R68*	probably null	Het
Prob1	T	C	18: 35,654,782	S140G	probably benign	Het
Ptprn2	A	T	12: 117,255,595	N949Y	probably damaging	Het
Qser1	C	A	2: 104,787,123	D1115Y	probably damaging	Het
Rad54l	G	T	4: 116,097,469	D674E	probably damaging	Het
Ripk4	T	A	16: 97,744,187	D420V	probably damaging	Het
Ros1	G	T	10: 52,077,971	S1857R	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Homo
Rsf1	A	G	7: 97,662,109	E682G	probably benign	Het
Samd4	G	A	14: 47,087,872	R515H	probably damaging	Het
Selp	T	A	1: 164,141,510	W560R	probably benign	Het
Shc3	A	T	13: 51,461,432	L163Q	probably damaging	Het
Shh	G	A	5: 28,461,399	A163V	probably damaging	Het
Slc17a8	T	C	10: 89,592,075	R113G	possibly damaging	Het
Slc5a6	C	A	5: 31,048,824		probably benign	Het
Smarcd2	A	G	11: 106,266,889		probably null	Het
Sytl3	A	G	17: 6,728,265	D148G	probably damaging	Het
Trbv21	A	T	6: 41,202,634		probably benign	Het
Ube3c	T	C	5: 29,601,163	F268L	probably benign	Het
Ugt2b5	T	C	5: 87,139,682	I209V	probably benign	Het
Usp1	A	G	4: 98,929,845	N140S	probably damaging	Het
Vcam1	T	C	3: 116,125,957	Y226C	probably damaging	Het
Vmn1r129	T	A	7: 21,360,609	Q228L	probably damaging	Het
Vmn1r209	T	A	13: 22,806,032	N163Y	probably benign	Het
Vmn1r85	A	G	7: 13,084,927	S97P	probably damaging	Het
Vmn2r30	C	T	7: 7,334,351	M95I	probably benign	Het
Vmn2r74	G	A	7: 85,951,890	R847C	probably damaging	Het
Wdr70	G	A	15: 7,887,349	T529I	possibly damaging	Het
Zfp532	T	G	18: 65,623,934	S313A	possibly damaging	Het
Zhx3	A	T	2: 160,779,543	N901K	probably benign	Het

Other mutations in Tnks

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Tnks	APN	8	34861689	splice site	probably benign
IGL00901:Tnks	APN	8	34838395	nonsense	probably null
IGL01448:Tnks	APN	8	34839982	missense	probably damaging	1.00
IGL01455:Tnks	APN	8	34940900	missense	probably damaging	0.99
IGL01962:Tnks	APN	8	34869524	missense	probably damaging	1.00
IGL02088:Tnks	APN	8	34839994	missense	possibly damaging	0.50
IGL02260:Tnks	APN	8	34842983	missense	probably damaging	0.99
IGL02454:Tnks	APN	8	34831728	unclassified	probably benign
IGL02486:Tnks	APN	8	34851198	missense	probably damaging	1.00
IGL02612:Tnks	APN	8	34849299	missense	possibly damaging	0.48
IGL03179:Tnks	APN	8	34848670	missense	probably benign	0.38
IGL03404:Tnks	APN	8	34940704	missense	probably damaging	1.00
R0256:Tnks	UTSW	8	34861547	missense	probably benign	0.07
R0265:Tnks	UTSW	8	34839970	nonsense	probably null
R0334:Tnks	UTSW	8	34853259	nonsense	probably null
R0414:Tnks	UTSW	8	34853309	missense	probably damaging	1.00
R0526:Tnks	UTSW	8	34853303	missense	probably benign	0.23
R0622:Tnks	UTSW	8	34940822	missense	probably damaging	1.00
R1445:Tnks	UTSW	8	34834603	splice site	probably benign
R1618:Tnks	UTSW	8	34875276	missense	probably damaging	1.00
R1779:Tnks	UTSW	8	34857518	missense	probably benign	0.18
R1919:Tnks	UTSW	8	34875232	missense	probably damaging	1.00
R1938:Tnks	UTSW	8	34838530	missense	probably damaging	1.00
R2018:Tnks	UTSW	8	34851106	missense	probably damaging	1.00
R2198:Tnks	UTSW	8	34848649	missense	probably benign
R2198:Tnks	UTSW	8	34873067	missense	probably benign	0.29
R2925:Tnks	UTSW	8	34965661	missense	unknown
R3828:Tnks	UTSW	8	34873178	missense	probably damaging	1.00
R3913:Tnks	UTSW	8	34873074	missense	probably damaging	0.99
R3916:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3917:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3930:Tnks	UTSW	8	34940812	missense	probably damaging	1.00
R4659:Tnks	UTSW	8	34849311	missense	possibly damaging	0.53
R4760:Tnks	UTSW	8	34851783	missense	probably benign	0.38
R5091:Tnks	UTSW	8	34841809	missense	probably benign	0.40
R5419:Tnks	UTSW	8	34965566	missense	unknown
R5558:Tnks	UTSW	8	34965665	start codon destroyed	probably null
R5582:Tnks	UTSW	8	34940861	missense	probably benign	0.14
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6495:Tnks	UTSW	8	34839966	critical splice donor site	probably null
R6527:Tnks	UTSW	8	34873093	missense	probably benign	0.36
R6991:Tnks	UTSW	8	34834493	missense	probably damaging	1.00
R7015:Tnks	UTSW	8	34838547	missense	probably benign	0.04
R7038:Tnks	UTSW	8	34851636	missense	probably damaging	0.99
R7057:Tnks	UTSW	8	34840014	missense	probably damaging	1.00
R7167:Tnks	UTSW	8	34849304	missense	probably damaging	0.98
R7250:Tnks	UTSW	8	34851758	missense	probably damaging	0.98
R7475:Tnks	UTSW	8	34831712	missense	probably damaging	1.00
R7790:Tnks	UTSW	8	34861540	missense	probably benign	0.01
R7818:Tnks	UTSW	8	34873028	missense	probably benign	0.03
R7909:Tnks	UTSW	8	34940704	missense	probably damaging	1.00
R7970:Tnks	UTSW	8	34855926	critical splice donor site	probably null
R8341:Tnks	UTSW	8	34873045	missense	probably damaging	1.00
R8343:Tnks	UTSW	8	34834584	missense	probably benign	0.03
R8870:Tnks	UTSW	8	34847279	critical splice donor site	probably null
R8936:Tnks	UTSW	8	34853347	nonsense	probably null
R9049:Tnks	UTSW	8	34841778	missense	probably damaging	0.96
R9080:Tnks	UTSW	8	34965312	small deletion	probably benign
R9182:Tnks	UTSW	8	34841751	critical splice donor site	probably null
R9211:Tnks	UTSW	8	34849335	missense	probably damaging	1.00
R9425:Tnks	UTSW	8	34873665	missense	probably damaging	1.00
R9649:Tnks	UTSW	8	34838935	missense	probably damaging	0.96
Z1177:Tnks	UTSW	8	34965145	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GCTGTAATTCTCAGTGCTATAAGC -3'
(R):5'- GAAGATCCTTTGCTGCAGTG -3'

Sequencing Primer
(F):5'- CAACACAATTAATAAGATGCACATCC -3'
(R):5'- AAGATCCTTTGCTGCAGTGCTTTTG -3'

Posted On

2017-08-16