Incidental Mutation 'R6035:Lman1l'
ID486516
Institutional Source Beutler Lab
Gene Symbol Lman1l
Ensembl Gene ENSMUSG00000056271
Gene Namelectin, mannose-binding 1 like
Synonyms
MMRRC Submission 044207-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6035 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location57607085-57620774 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 57611747 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044937] [ENSMUST00000093832]
Predicted Effect probably benign
Transcript: ENSMUST00000044937
SMART Domains Protein: ENSMUSP00000041631
Gene: ENSMUSG00000056271

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Lectin_leg-like 32 256 1.2e-53 PFAM
low complexity region 272 287 N/A INTRINSIC
coiled coil region 316 337 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093832
SMART Domains Protein: ENSMUSP00000091352
Gene: ENSMUSG00000056271

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Lectin_leg-like 32 256 2.7e-53 PFAM
low complexity region 272 287 N/A INTRINSIC
coiled coil region 316 337 N/A INTRINSIC
transmembrane domain 439 461 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 84% (62/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mannose-binding type 1 transmembrane protein that contains an N-terminal lectin-like carbohydrate recognition domain. The encoded protein is similar in structure to lectins found in leguminous plants. This lectin is thought to transport newly synthesized glycoproteins from the endoplasmic reticulum (ER) to the ER-Golgi intermediate compartment. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,638,394 G76W probably damaging Het
Abca17 A T 17: 24,281,245 F1324Y possibly damaging Het
Abca8b A T 11: 109,971,860 probably null Het
Abcc12 A G 8: 86,517,404 M1040T probably damaging Het
Abtb1 A G 6: 88,841,806 F7L probably damaging Het
Adcy9 T C 16: 4,304,513 T558A probably benign Het
Adgrb1 A T 15: 74,540,443 T424S possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd31 C A 13: 96,832,213 P786Q probably benign Het
Arhgap39 G T 15: 76,737,224 Y392* probably null Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Carmil2 G T 8: 105,692,563 W749L probably benign Het
Ccar1 A G 10: 62,751,785 Y867H unknown Het
Cdh13 A G 8: 118,505,698 D47G probably benign Het
Chst9 T A 18: 15,452,853 T218S probably benign Het
Clec2i G A 6: 128,893,624 V67I probably benign Het
Cox7a2 T A 9: 79,759,746 probably benign Het
Cpz A G 5: 35,517,585 C107R probably damaging Het
Dapk1 T A 13: 60,761,199 C1209S possibly damaging Het
Ddx41 T C 13: 55,533,968 M307V probably benign Het
Defa24 A G 8: 21,734,549 I5V probably benign Het
Dgcr8 A T 16: 18,258,314 N2K probably damaging Het
Ebf2 A G 14: 67,238,974 D131G probably damaging Het
Fam149b C T 14: 20,377,917 R424C probably damaging Het
Fbln2 G A 6: 91,263,353 V714M probably damaging Het
Fgf5 T C 5: 98,275,526 Y257H probably damaging Het
Fmo3 A C 1: 162,964,036 V224G probably damaging Het
Gigyf2 T C 1: 87,410,728 I394T possibly damaging Het
Glmn T A 5: 107,593,880 probably null Het
Greb1l T C 18: 10,501,025 I385T possibly damaging Het
Grhl1 C A 12: 24,608,450 Q365K probably benign Het
Gsdme G A 6: 50,229,326 T179M probably damaging Het
Gtf2a1l A G 17: 88,711,534 T349A probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Il5ra G A 6: 106,741,265 T76I probably damaging Het
Itga8 T C 2: 12,191,714 T631A probably benign Het
Kcnh6 G A 11: 106,019,152 probably null Het
Krt26 C T 11: 99,333,589 E368K probably benign Het
Lhx9 T C 1: 138,838,543 D169G possibly damaging Het
Lmod3 A G 6: 97,247,273 L529P probably damaging Het
Nup155 A G 15: 8,144,093 T891A probably benign Het
Olfr20 T C 11: 73,353,756 M1T probably null Het
Olfr341 T A 2: 36,479,984 I49F probably damaging Het
Olfr409-ps1 T C 11: 74,317,459 *145R probably null Het
Olfr739 A G 14: 50,424,527 T3A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Papln G C 12: 83,774,680 G262A probably damaging Het
Pdcd1lg2 G A 19: 29,446,035 V160I probably benign Het
Pde8b A G 13: 95,027,597 probably benign Het
Ppme1 G A 7: 100,354,795 R68* probably null Het
Prob1 T C 18: 35,654,782 S140G probably benign Het
Ptprn2 A T 12: 117,255,595 N949Y probably damaging Het
Qser1 C A 2: 104,787,123 D1115Y probably damaging Het
Rad54l G T 4: 116,097,469 D674E probably damaging Het
Ripk4 T A 16: 97,744,187 D420V probably damaging Het
Ros1 G T 10: 52,077,971 S1857R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 A G 7: 97,662,109 E682G probably benign Het
Samd4 G A 14: 47,087,872 R515H probably damaging Het
Selp T A 1: 164,141,510 W560R probably benign Het
Shc3 A T 13: 51,461,432 L163Q probably damaging Het
Shh G A 5: 28,461,399 A163V probably damaging Het
Slc17a8 T C 10: 89,592,075 R113G possibly damaging Het
Slc5a6 C A 5: 31,048,824 probably benign Het
Smarcd2 A G 11: 106,266,889 probably null Het
Sytl3 A G 17: 6,728,265 D148G probably damaging Het
Tnks G T 8: 34,918,461 H297Q possibly damaging Het
Trbv21 A T 6: 41,202,634 probably benign Het
Ube3c T C 5: 29,601,163 F268L probably benign Het
Ugt2b5 T C 5: 87,139,682 I209V probably benign Het
Usp1 A G 4: 98,929,845 N140S probably damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn1r129 T A 7: 21,360,609 Q228L probably damaging Het
Vmn1r209 T A 13: 22,806,032 N163Y probably benign Het
Vmn1r85 A G 7: 13,084,927 S97P probably damaging Het
Vmn2r30 C T 7: 7,334,351 M95I probably benign Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Wdr70 G A 15: 7,887,349 T529I possibly damaging Het
Zfp532 T G 18: 65,623,934 S313A possibly damaging Het
Zhx3 A T 2: 160,779,543 N901K probably benign Het
Other mutations in Lman1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Lman1l APN 9 57620564 missense probably damaging 1.00
IGL03164:Lman1l APN 9 57609995 missense probably damaging 0.99
IGL03226:Lman1l APN 9 57610007 missense probably benign 0.43
PIT4283001:Lman1l UTSW 9 57616076 missense probably damaging 1.00
R0555:Lman1l UTSW 9 57614101 missense probably benign 0.15
R1168:Lman1l UTSW 9 57608312 missense probably benign 0.00
R1169:Lman1l UTSW 9 57609995 missense probably damaging 0.99
R1591:Lman1l UTSW 9 57615802 missense probably benign 0.30
R2289:Lman1l UTSW 9 57613658 missense possibly damaging 0.76
R3848:Lman1l UTSW 9 57608317 missense possibly damaging 0.48
R4685:Lman1l UTSW 9 57609200 missense probably damaging 0.98
R5170:Lman1l UTSW 9 57615619 nonsense probably null
R5309:Lman1l UTSW 9 57611077 missense probably damaging 0.98
R5312:Lman1l UTSW 9 57611077 missense probably damaging 0.98
R5639:Lman1l UTSW 9 57611866 missense probably benign 0.24
R5655:Lman1l UTSW 9 57615975 missense probably damaging 1.00
R5905:Lman1l UTSW 9 57608263 missense probably damaging 1.00
R6011:Lman1l UTSW 9 57615755 missense probably damaging 1.00
R6028:Lman1l UTSW 9 57608263 missense probably damaging 1.00
R6035:Lman1l UTSW 9 57611747 critical splice donor site probably null
R6250:Lman1l UTSW 9 57615624 missense probably benign 0.00
R6488:Lman1l UTSW 9 57620643 missense possibly damaging 0.73
R6489:Lman1l UTSW 9 57613726 splice site probably null
R6720:Lman1l UTSW 9 57614072 splice site probably null
R7000:Lman1l UTSW 9 57615948 missense probably benign 0.27
R7139:Lman1l UTSW 9 57615596 missense probably benign 0.37
X0057:Lman1l UTSW 9 57615957 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCTGGAAAATGGGTCTCAG -3'
(R):5'- AGTACTCCCATGCATTTGCC -3'

Sequencing Primer
(F):5'- CCTGACAATGTAAGCTTGATCC -3'
(R):5'- CCATGCATTTGCCTTTGGG -3'
Posted On2017-08-16