Incidental Mutation 'R6035:Chst9'
ID486551
Institutional Source Beutler Lab
Gene Symbol Chst9
Ensembl Gene ENSMUSG00000047161
Gene Namecarbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
Synonyms5430438D01Rik, GalNAc4ST-2
MMRRC Submission 044207-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R6035 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location15451924-15760157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15452853 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 218 (T218S)
Ref Sequence ENSEMBL: ENSMUSP00000049975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053017] [ENSMUST00000130553]
Predicted Effect probably benign
Transcript: ENSMUST00000053017
AA Change: T218S

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049975
Gene: ENSMUSG00000047161
AA Change: T218S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
Pfam:Sulfotransfer_2 174 409 1.9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130553
SMART Domains Protein: ENSMUSP00000121484
Gene: ENSMUSG00000047161

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 84% (62/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sulfotransferase 2 family. It is localized to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of non-reducing N-acetylgalactosamine (GalNAc) residues in both N-glycans and O-glycans. Sulfate groups on carbohydrates confer highly specific functions to glycoproteins, glycolipids, and proteoglycans, and are critical for cell-cell interaction, signal transduction, and embryonic development. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,638,394 G76W probably damaging Het
Abca17 A T 17: 24,281,245 F1324Y possibly damaging Het
Abca8b A T 11: 109,971,860 probably null Het
Abcc12 A G 8: 86,517,404 M1040T probably damaging Het
Abtb1 A G 6: 88,841,806 F7L probably damaging Het
Adcy9 T C 16: 4,304,513 T558A probably benign Het
Adgrb1 A T 15: 74,540,443 T424S possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd31 C A 13: 96,832,213 P786Q probably benign Het
Arhgap39 G T 15: 76,737,224 Y392* probably null Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Carmil2 G T 8: 105,692,563 W749L probably benign Het
Ccar1 A G 10: 62,751,785 Y867H unknown Het
Cdh13 A G 8: 118,505,698 D47G probably benign Het
Clec2i G A 6: 128,893,624 V67I probably benign Het
Cox7a2 T A 9: 79,759,746 probably benign Het
Cpz A G 5: 35,517,585 C107R probably damaging Het
Dapk1 T A 13: 60,761,199 C1209S possibly damaging Het
Ddx41 T C 13: 55,533,968 M307V probably benign Het
Defa24 A G 8: 21,734,549 I5V probably benign Het
Dgcr8 A T 16: 18,258,314 N2K probably damaging Het
Ebf2 A G 14: 67,238,974 D131G probably damaging Het
Fam149b C T 14: 20,377,917 R424C probably damaging Het
Fbln2 G A 6: 91,263,353 V714M probably damaging Het
Fgf5 T C 5: 98,275,526 Y257H probably damaging Het
Fmo3 A C 1: 162,964,036 V224G probably damaging Het
Gigyf2 T C 1: 87,410,728 I394T possibly damaging Het
Glmn T A 5: 107,593,880 probably null Het
Greb1l T C 18: 10,501,025 I385T possibly damaging Het
Grhl1 C A 12: 24,608,450 Q365K probably benign Het
Gsdme G A 6: 50,229,326 T179M probably damaging Het
Gtf2a1l A G 17: 88,711,534 T349A probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Il5ra G A 6: 106,741,265 T76I probably damaging Het
Itga8 T C 2: 12,191,714 T631A probably benign Het
Kcnh6 G A 11: 106,019,152 probably null Het
Krt26 C T 11: 99,333,589 E368K probably benign Het
Lhx9 T C 1: 138,838,543 D169G possibly damaging Het
Lman1l A G 9: 57,611,747 probably null Het
Lmod3 A G 6: 97,247,273 L529P probably damaging Het
Nup155 A G 15: 8,144,093 T891A probably benign Het
Olfr20 T C 11: 73,353,756 M1T probably null Het
Olfr341 T A 2: 36,479,984 I49F probably damaging Het
Olfr409-ps1 T C 11: 74,317,459 *145R probably null Het
Olfr739 A G 14: 50,424,527 T3A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Papln G C 12: 83,774,680 G262A probably damaging Het
Pdcd1lg2 G A 19: 29,446,035 V160I probably benign Het
Pde8b A G 13: 95,027,597 probably benign Het
Ppme1 G A 7: 100,354,795 R68* probably null Het
Prob1 T C 18: 35,654,782 S140G probably benign Het
Ptprn2 A T 12: 117,255,595 N949Y probably damaging Het
Qser1 C A 2: 104,787,123 D1115Y probably damaging Het
Rad54l G T 4: 116,097,469 D674E probably damaging Het
Ripk4 T A 16: 97,744,187 D420V probably damaging Het
Ros1 G T 10: 52,077,971 S1857R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 A G 7: 97,662,109 E682G probably benign Het
Samd4 G A 14: 47,087,872 R515H probably damaging Het
Selp T A 1: 164,141,510 W560R probably benign Het
Shc3 A T 13: 51,461,432 L163Q probably damaging Het
Shh G A 5: 28,461,399 A163V probably damaging Het
Slc17a8 T C 10: 89,592,075 R113G possibly damaging Het
Slc5a6 C A 5: 31,048,824 probably benign Het
Smarcd2 A G 11: 106,266,889 probably null Het
Sytl3 A G 17: 6,728,265 D148G probably damaging Het
Tnks G T 8: 34,918,461 H297Q possibly damaging Het
Trbv21 A T 6: 41,202,634 probably benign Het
Ube3c T C 5: 29,601,163 F268L probably benign Het
Ugt2b5 T C 5: 87,139,682 I209V probably benign Het
Usp1 A G 4: 98,929,845 N140S probably damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn1r129 T A 7: 21,360,609 Q228L probably damaging Het
Vmn1r209 T A 13: 22,806,032 N163Y probably benign Het
Vmn1r85 A G 7: 13,084,927 S97P probably damaging Het
Vmn2r30 C T 7: 7,334,351 M95I probably benign Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Wdr70 G A 15: 7,887,349 T529I possibly damaging Het
Zfp532 T G 18: 65,623,934 S313A possibly damaging Het
Zhx3 A T 2: 160,779,543 N901K probably benign Het
Other mutations in Chst9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Chst9 APN 18 15453030 missense probably benign 0.34
IGL01910:Chst9 APN 18 15452874 missense possibly damaging 0.90
IGL03038:Chst9 APN 18 15495303 missense probably benign
IGL03146:Chst9 APN 18 15452978 missense probably damaging 1.00
PIT4802001:Chst9 UTSW 18 15452792 missense probably benign 0.01
R0536:Chst9 UTSW 18 15495330 splice site probably benign
R0647:Chst9 UTSW 18 15452669 missense probably damaging 1.00
R1240:Chst9 UTSW 18 15453174 missense probably benign
R1580:Chst9 UTSW 18 15453065 missense probably benign 0.02
R1892:Chst9 UTSW 18 15452960 missense probably damaging 1.00
R2420:Chst9 UTSW 18 15452284 missense probably damaging 1.00
R2446:Chst9 UTSW 18 15452838 missense possibly damaging 0.90
R4737:Chst9 UTSW 18 15452777 missense probably damaging 1.00
R4790:Chst9 UTSW 18 15453050 missense probably damaging 1.00
R4956:Chst9 UTSW 18 15717988 missense probably damaging 1.00
R5202:Chst9 UTSW 18 15453239 missense probably benign 0.02
R5402:Chst9 UTSW 18 15452815 missense probably damaging 0.98
R5754:Chst9 UTSW 18 15453197 missense possibly damaging 0.77
R6035:Chst9 UTSW 18 15452853 missense probably benign 0.13
R7225:Chst9 UTSW 18 15452661 missense probably damaging 0.99
R7801:Chst9 UTSW 18 15452277 missense probably benign 0.00
R7896:Chst9 UTSW 18 15452789 missense probably damaging 1.00
R8159:Chst9 UTSW 18 15452308 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATTGCCTTTCCAAACACCGG -3'
(R):5'- GAAGCGTCGGTCATTCCTTC -3'

Sequencing Primer
(F):5'- CCGGATGGTAGTAACTATTGGGATGC -3'
(R):5'- AGCGTCGGTCATTCCTTCATGAG -3'
Posted On2017-08-16