Mutagenetix > Incidental Mutation

Incidental Mutation 'R6035:Afg3l2'

486553

Institutional Source

Beutler Lab

Gene Symbol

Afg3l2

Ensembl Gene

ENSMUSG00000024527

Gene Name

AFG3-like AAA ATPase 2

Synonyms

2310036I02Rik, Emv66, par

MMRRC Submission

044207-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6035 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67404767-67449166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 67421259 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 458 (L458M)

Ref Sequence

ENSEMBL: ENSMUSP00000025408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025408]

AlphaFold

Q8JZQ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000025408
AA Change: L458M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: L458M

Domain	Start	End	E-Value	Type
low complexity region	95	121	N/A	INTRINSIC
Pfam:FtsH_ext	144	241	8.8e-12	PFAM
transmembrane domain	251	270	N/A	INTRINSIC
low complexity region	271	286	N/A	INTRINSIC
AAA	339	478	1.37e-23	SMART
Pfam:Peptidase_M41	540	743	4e-77	PFAM
low complexity region	780	794	N/A	INTRINSIC

Meta Mutation Damage Score

0.3865

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

84% (62/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	G	T	6: 121,638,394	G76W	probably damaging	Het
Abca17	A	T	17: 24,281,245	F1324Y	possibly damaging	Het
Abca8b	A	T	11: 109,971,860		probably null	Het
Abcc12	A	G	8: 86,517,404	M1040T	probably damaging	Het
Abtb1	A	G	6: 88,841,806	F7L	probably damaging	Het
Adcy9	T	C	16: 4,304,513	T558A	probably benign	Het
Adgrb1	A	T	15: 74,540,443	T424S	possibly damaging	Het
Ankrd31	C	A	13: 96,832,213	P786Q	probably benign	Het
Arhgap39	G	T	15: 76,737,224	Y392*	probably null	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Carmil2	G	T	8: 105,692,563	W749L	probably benign	Het
Ccar1	A	G	10: 62,751,785	Y867H	unknown	Het
Cdh13	A	G	8: 118,505,698	D47G	probably benign	Het
Chst9	T	A	18: 15,452,853	T218S	probably benign	Het
Clec2i	G	A	6: 128,893,624	V67I	probably benign	Het
Cox7a2	T	A	9: 79,759,746		probably benign	Het
Cpz	A	G	5: 35,517,585	C107R	probably damaging	Het
Dapk1	T	A	13: 60,761,199	C1209S	possibly damaging	Het
Ddx41	T	C	13: 55,533,968	M307V	probably benign	Het
Defa24	A	G	8: 21,734,549	I5V	probably benign	Het
Dgcr8	A	T	16: 18,258,314	N2K	probably damaging	Het
Ebf2	A	G	14: 67,238,974	D131G	probably damaging	Het
Fam149b	C	T	14: 20,377,917	R424C	probably damaging	Het
Fbln2	G	A	6: 91,263,353	V714M	probably damaging	Het
Fgf5	T	C	5: 98,275,526	Y257H	probably damaging	Het
Fmo3	A	C	1: 162,964,036	V224G	probably damaging	Het
Gigyf2	T	C	1: 87,410,728	I394T	possibly damaging	Het
Glmn	T	A	5: 107,593,880		probably null	Het
Greb1l	T	C	18: 10,501,025	I385T	possibly damaging	Het
Grhl1	C	A	12: 24,608,450	Q365K	probably benign	Het
Gsdme	G	A	6: 50,229,326	T179M	probably damaging	Het
Gtf2a1l	A	G	17: 88,711,534	T349A	probably benign	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,997,940		probably benign	Het
Il5ra	G	A	6: 106,741,265	T76I	probably damaging	Het
Itga8	T	C	2: 12,191,714	T631A	probably benign	Het
Kcnh6	G	A	11: 106,019,152		probably null	Het
Krt26	C	T	11: 99,333,589	E368K	probably benign	Het
Lhx9	T	C	1: 138,838,543	D169G	possibly damaging	Het
Lman1l	A	G	9: 57,611,747		probably null	Het
Lmod3	A	G	6: 97,247,273	L529P	probably damaging	Het
Nup155	A	G	15: 8,144,093	T891A	probably benign	Het
Olfr20	T	C	11: 73,353,756	M1T	probably null	Het
Olfr341	T	A	2: 36,479,984	I49F	probably damaging	Het
Olfr409-ps1	T	C	11: 74,317,459	*145R	probably null	Het
Olfr739	A	G	14: 50,424,527	T3A	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Papln	G	C	12: 83,774,680	G262A	probably damaging	Het
Pdcd1lg2	G	A	19: 29,446,035	V160I	probably benign	Het
Pde8b	A	G	13: 95,027,597		probably benign	Het
Ppme1	G	A	7: 100,354,795	R68*	probably null	Het
Prob1	T	C	18: 35,654,782	S140G	probably benign	Het
Ptprn2	A	T	12: 117,255,595	N949Y	probably damaging	Het
Qser1	C	A	2: 104,787,123	D1115Y	probably damaging	Het
Rad54l	G	T	4: 116,097,469	D674E	probably damaging	Het
Ripk4	T	A	16: 97,744,187	D420V	probably damaging	Het
Ros1	G	T	10: 52,077,971	S1857R	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Homo
Rsf1	A	G	7: 97,662,109	E682G	probably benign	Het
Samd4	G	A	14: 47,087,872	R515H	probably damaging	Het
Selp	T	A	1: 164,141,510	W560R	probably benign	Het
Shc3	A	T	13: 51,461,432	L163Q	probably damaging	Het
Shh	G	A	5: 28,461,399	A163V	probably damaging	Het
Slc17a8	T	C	10: 89,592,075	R113G	possibly damaging	Het
Slc5a6	C	A	5: 31,048,824		probably benign	Het
Smarcd2	A	G	11: 106,266,889		probably null	Het
Sytl3	A	G	17: 6,728,265	D148G	probably damaging	Het
Tnks	G	T	8: 34,918,461	H297Q	possibly damaging	Het
Trbv21	A	T	6: 41,202,634		probably benign	Het
Ube3c	T	C	5: 29,601,163	F268L	probably benign	Het
Ugt2b5	T	C	5: 87,139,682	I209V	probably benign	Het
Usp1	A	G	4: 98,929,845	N140S	probably damaging	Het
Vcam1	T	C	3: 116,125,957	Y226C	probably damaging	Het
Vmn1r129	T	A	7: 21,360,609	Q228L	probably damaging	Het
Vmn1r209	T	A	13: 22,806,032	N163Y	probably benign	Het
Vmn1r85	A	G	7: 13,084,927	S97P	probably damaging	Het
Vmn2r30	C	T	7: 7,334,351	M95I	probably benign	Het
Vmn2r74	G	A	7: 85,951,890	R847C	probably damaging	Het
Wdr70	G	A	15: 7,887,349	T529I	possibly damaging	Het
Zfp532	T	G	18: 65,623,934	S313A	possibly damaging	Het
Zhx3	A	T	2: 160,779,543	N901K	probably benign	Het

Other mutations in Afg3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00962:Afg3l2	APN	18	67431653	critical splice donor site	probably null
IGL01395:Afg3l2	APN	18	67442810	missense	probably benign	0.21
IGL01533:Afg3l2	APN	18	67405418	nonsense	probably null
IGL01814:Afg3l2	APN	18	67405474	missense	probably benign	0.23
IGL01868:Afg3l2	APN	18	67414148	missense	possibly damaging	0.83
IGL02399:Afg3l2	APN	18	67429040	missense	possibly damaging	0.82
IGL02827:Afg3l2	APN	18	67425945	missense	probably damaging	1.00
IGL03342:Afg3l2	APN	18	67407320	missense	probably benign
IGL03392:Afg3l2	APN	18	67414069	splice site	probably benign
radicle	UTSW	18	67422953	missense	probably damaging	1.00
rootlet	UTSW	18	67421259	missense	probably damaging	1.00
R0057:Afg3l2	UTSW	18	67423086	missense	probably damaging	1.00
R0107:Afg3l2	UTSW	18	67431766	missense	probably damaging	1.00
R0650:Afg3l2	UTSW	18	67415557	missense	possibly damaging	0.77
R0831:Afg3l2	UTSW	18	67421227	missense	probably damaging	1.00
R0899:Afg3l2	UTSW	18	67422977	missense	possibly damaging	0.65
R0962:Afg3l2	UTSW	18	67405427	missense	possibly damaging	0.77
R1672:Afg3l2	UTSW	18	67407423	missense	probably benign	0.31
R1815:Afg3l2	UTSW	18	67415573	nonsense	probably null
R1838:Afg3l2	UTSW	18	67414172	missense	probably damaging	0.99
R2013:Afg3l2	UTSW	18	67431772	missense	probably damaging	0.99
R2383:Afg3l2	UTSW	18	67422956	missense	possibly damaging	0.91
R2906:Afg3l2	UTSW	18	67440222	missense	probably damaging	1.00
R4763:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4765:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4775:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5193:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5196:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5197:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5257:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5361:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5362:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5363:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5397:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5588:Afg3l2	UTSW	18	67440207	missense	possibly damaging	0.88
R5605:Afg3l2	UTSW	18	67442355	nonsense	probably null
R5696:Afg3l2	UTSW	18	67407459	missense	probably damaging	1.00
R5722:Afg3l2	UTSW	18	67440199	missense	probably benign	0.44
R5779:Afg3l2	UTSW	18	67440443	missense	probably null	0.12
R5972:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5973:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5974:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5979:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5994:Afg3l2	UTSW	18	67429070	missense	probably damaging	1.00
R6026:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6027:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6028:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6029:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6075:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6077:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6081:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6131:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6132:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6134:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6152:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6154:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6169:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6178:Afg3l2	UTSW	18	67409528	missense	possibly damaging	0.91
R6187:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6216:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6718:Afg3l2	UTSW	18	67421276	missense	probably damaging	1.00
R7388:Afg3l2	UTSW	18	67422953	missense	probably damaging	1.00
R8479:Afg3l2	UTSW	18	67448916	missense	probably benign	0.05
R8531:Afg3l2	UTSW	18	67407369	missense	probably damaging	0.99
R9017:Afg3l2	UTSW	18	67409480	missense	possibly damaging	0.81
R9220:Afg3l2	UTSW	18	67429196	missense	probably benign
R9222:Afg3l2	UTSW	18	67434187	missense	probably benign	0.05
R9371:Afg3l2	UTSW	18	67434192	missense	possibly damaging	0.84
R9381:Afg3l2	UTSW	18	67442381	missense	probably damaging	1.00
R9562:Afg3l2	UTSW	18	67421295	missense	probably damaging	1.00
Z1176:Afg3l2	UTSW	18	67431707	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GGCACTGTCCAGCTTCAATG -3'
(R):5'- AGTTTACATCTTGATTGTAGCTCCC -3'

Sequencing Primer
(F):5'- TCCAGCTTCAATGGTCGAAG -3'
(R):5'- GATTGTAGCTCCCCTCTCCAG -3'

Posted On

2017-08-16