Incidental Mutation 'R6036:Olfr1288'
ID486559
Institutional Source Beutler Lab
Gene Symbol Olfr1288
Ensembl Gene ENSMUSG00000044039
Gene Nameolfactory receptor 1288
SynonymsMOR245-9, GA_x6K02T2Q125-72530279-72531217
MMRRC Submission 043257-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6036 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location111474101-111479994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111478988 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 68 (L68P)
Ref Sequence ENSEMBL: ENSMUSP00000150331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104889] [ENSMUST00000120021] [ENSMUST00000207494] [ENSMUST00000214816]
Predicted Effect probably damaging
Transcript: ENSMUST00000104889
AA Change: L68P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100485
Gene: ENSMUSG00000044039
AA Change: L68P

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-43 PFAM
Pfam:7tm_1 41 287 2.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120021
Predicted Effect probably benign
Transcript: ENSMUST00000207494
Predicted Effect probably damaging
Transcript: ENSMUST00000214816
AA Change: L68P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225425
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 T C 11: 95,832,858 probably benign Het
Ago1 C T 4: 126,443,228 R228H probably damaging Het
Alpk3 G A 7: 81,093,257 V941M probably benign Het
Ano4 A G 10: 88,982,265 W588R possibly damaging Het
Atp6v1a A G 16: 44,098,831 Y464H probably benign Het
Barx2 A T 9: 31,913,008 D28E probably damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Col10a1 A G 10: 34,395,282 T417A probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eif4enif1 T C 11: 3,239,420 S227P probably damaging Het
Erv3 G A 2: 131,856,005 H145Y possibly damaging Het
Exoc5 T C 14: 49,014,322 T591A possibly damaging Het
F5 A T 1: 164,184,996 E493V probably damaging Het
Gm8444 G T 15: 81,843,593 probably benign Het
Gria4 T A 9: 4,537,646 I221L probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hc T C 2: 35,039,684 T249A probably benign Het
Herc2 A G 7: 56,068,053 T48A probably benign Het
Hist1h2bl A T 13: 21,715,978 S56T probably damaging Het
Hp A G 8: 109,576,774 probably null Het
Ifna15 T G 4: 88,558,073 D58A possibly damaging Het
Kcnj1 A T 9: 32,397,125 M262L probably benign Het
Krt83 A C 15: 101,487,531 I320S possibly damaging Het
Megf10 A G 18: 57,242,727 N242D probably damaging Het
Nup155 A G 15: 8,128,411 T451A probably benign Het
Olfr1277 C T 2: 111,269,612 G252R probably damaging Het
Olfr559 T A 7: 102,724,485 I2F probably benign Het
Olfr701 A T 7: 106,818,460 I126F probably damaging Het
Olfr930 A G 9: 38,930,920 I250V probably damaging Het
Pdzd8 G A 19: 59,305,209 P403S probably damaging Het
Piezo2 G A 18: 63,114,948 Q494* probably null Het
Pik3c2b T C 1: 133,090,713 F966S possibly damaging Het
Plag1 T C 4: 3,904,618 E191G possibly damaging Het
Pou4f2 A T 8: 78,435,474 S167T probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scd4 G A 19: 44,344,792 D319N probably damaging Het
Senp2 A T 16: 22,028,558 R279* probably null Het
Sh3rf3 G A 10: 58,813,984 G137D probably benign Het
Simc1 C T 13: 54,524,621 P261S probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc26a1 T A 5: 108,673,570 D151V probably damaging Het
Snx29 A G 16: 11,738,437 probably null Het
Stard9 C T 2: 120,700,075 A2271V probably benign Het
Stat6 A G 10: 127,655,444 N485D possibly damaging Het
Tpcn2 T C 7: 145,268,869 T280A possibly damaging Het
Ttc23 A G 7: 67,711,366 I378V possibly damaging Het
Ttc29 A G 8: 78,325,576 D362G probably benign Het
Ttll7 A G 3: 146,940,162 I592V probably benign Het
Ugt3a1 A T 15: 9,306,086 H107L probably benign Het
Vmn1r70 A G 7: 10,633,903 Q87R probably damaging Het
Vmn2r-ps129 T C 17: 22,995,172 noncoding transcript Het
Wdfy4 G T 14: 33,146,990 S360R probably damaging Het
Zfp780b A G 7: 27,963,568 Y521H probably damaging Het
Other mutations in Olfr1288
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Olfr1288 APN 2 111478864 missense probably benign
IGL02021:Olfr1288 APN 2 111479480 missense probably benign 0.03
IGL02061:Olfr1288 APN 2 111479269 missense possibly damaging 0.94
R2016:Olfr1288 UTSW 2 111479187 missense probably benign 0.00
R2017:Olfr1288 UTSW 2 111479187 missense probably benign 0.00
R2848:Olfr1288 UTSW 2 111479354 missense probably benign 0.00
R2849:Olfr1288 UTSW 2 111479354 missense probably benign 0.00
R3421:Olfr1288 UTSW 2 111478952 missense probably benign 0.12
R4223:Olfr1288 UTSW 2 111479144 missense probably benign 0.00
R4432:Olfr1288 UTSW 2 111479412 nonsense probably null
R4433:Olfr1288 UTSW 2 111479412 nonsense probably null
R4476:Olfr1288 UTSW 2 111479664 missense possibly damaging 0.58
R4631:Olfr1288 UTSW 2 111479563 missense probably damaging 1.00
R6029:Olfr1288 UTSW 2 111478965 nonsense probably null
R6036:Olfr1288 UTSW 2 111478988 missense probably damaging 1.00
R6084:Olfr1288 UTSW 2 111479389 missense probably damaging 1.00
R6329:Olfr1288 UTSW 2 111479228 missense possibly damaging 0.90
R7307:Olfr1288 UTSW 2 111478760 start gained probably benign
R7516:Olfr1288 UTSW 2 111478937 missense probably benign 0.01
R7577:Olfr1288 UTSW 2 111479132 missense probably damaging 0.98
R8108:Olfr1288 UTSW 2 111479234 missense possibly damaging 0.90
R8210:Olfr1288 UTSW 2 111479408 missense possibly damaging 0.89
Z1177:Olfr1288 UTSW 2 111478814 missense probably benign 0.06
Z1177:Olfr1288 UTSW 2 111479207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACCAAGTTAATGCTTCTGCTC -3'
(R):5'- CATCAGGTAGTGAAGAGGCTTG -3'

Sequencing Primer
(F):5'- AAGTTAATGCTTCTGCTCTACCTG -3'
(R):5'- GAGGCTTGCAGATTGCTATATATC -3'
Posted On2017-08-16