Incidental Mutation 'R6036:Plag1'
ID486563
Institutional Source Beutler Lab
Gene Symbol Plag1
Ensembl Gene ENSMUSG00000003282
Gene Namepleiomorphic adenoma gene 1
Synonyms
MMRRC Submission 043257-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.701) question?
Stock #R6036 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location3900996-3938423 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3904618 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 191 (E191G)
Ref Sequence ENSEMBL: ENSMUSP00000003369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003369] [ENSMUST00000137439] [ENSMUST00000151543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003369
AA Change: E191G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003369
Gene: ENSMUSG00000003282
AA Change: E191G

DomainStartEndE-ValueType
ZnF_C2H2 34 56 2.2e-2 SMART
ZnF_C2H2 62 86 1.6e-4 SMART
ZnF_C2H2 92 114 1.89e-1 SMART
ZnF_C2H2 121 143 5.99e-4 SMART
ZnF_C2H2 150 172 2.86e-1 SMART
ZnF_C2H2 185 207 1.03e-2 SMART
ZnF_C2H2 213 236 8.94e-3 SMART
low complexity region 364 379 N/A INTRINSIC
low complexity region 396 411 N/A INTRINSIC
low complexity region 471 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137439
Predicted Effect probably benign
Transcript: ENSMUST00000151543
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pleomorphic adenoma gene 1 encodes a zinc finger protein with 2 putative nuclear localization signals. PLAG1, which is developmentally regulated, has been shown to be consistently rearranged in pleomorphic adenomas of the salivary glands. PLAG1 is activated by the reciprocal chromosomal translocations involving 8q12 in a subset of salivary gland pleomorphic adenomas. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced male fertility, small seminal vesicles and ventral prostate, reduced litter size (females only), reduced embryonic and postnatal growth, and delayed eyelid opening. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 T C 11: 95,832,858 probably benign Het
Ago1 C T 4: 126,443,228 R228H probably damaging Het
Alpk3 G A 7: 81,093,257 V941M probably benign Het
Ano4 A G 10: 88,982,265 W588R possibly damaging Het
Atp6v1a A G 16: 44,098,831 Y464H probably benign Het
Barx2 A T 9: 31,913,008 D28E probably damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Col10a1 A G 10: 34,395,282 T417A probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eif4enif1 T C 11: 3,239,420 S227P probably damaging Het
Erv3 G A 2: 131,856,005 H145Y possibly damaging Het
Exoc5 T C 14: 49,014,322 T591A possibly damaging Het
F5 A T 1: 164,184,996 E493V probably damaging Het
Gm8444 G T 15: 81,843,593 probably benign Het
Gria4 T A 9: 4,537,646 I221L probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hc T C 2: 35,039,684 T249A probably benign Het
Herc2 A G 7: 56,068,053 T48A probably benign Het
Hist1h2bl A T 13: 21,715,978 S56T probably damaging Het
Hp A G 8: 109,576,774 probably null Het
Ifna15 T G 4: 88,558,073 D58A possibly damaging Het
Kcnj1 A T 9: 32,397,125 M262L probably benign Het
Krt83 A C 15: 101,487,531 I320S possibly damaging Het
Megf10 A G 18: 57,242,727 N242D probably damaging Het
Nup155 A G 15: 8,128,411 T451A probably benign Het
Olfr1277 C T 2: 111,269,612 G252R probably damaging Het
Olfr1288 T C 2: 111,478,988 L68P probably damaging Het
Olfr559 T A 7: 102,724,485 I2F probably benign Het
Olfr701 A T 7: 106,818,460 I126F probably damaging Het
Olfr930 A G 9: 38,930,920 I250V probably damaging Het
Pdzd8 G A 19: 59,305,209 P403S probably damaging Het
Piezo2 G A 18: 63,114,948 Q494* probably null Het
Pik3c2b T C 1: 133,090,713 F966S possibly damaging Het
Pou4f2 A T 8: 78,435,474 S167T probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scd4 G A 19: 44,344,792 D319N probably damaging Het
Senp2 A T 16: 22,028,558 R279* probably null Het
Sh3rf3 G A 10: 58,813,984 G137D probably benign Het
Simc1 C T 13: 54,524,621 P261S probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc26a1 T A 5: 108,673,570 D151V probably damaging Het
Snx29 A G 16: 11,738,437 probably null Het
Stard9 C T 2: 120,700,075 A2271V probably benign Het
Stat6 A G 10: 127,655,444 N485D possibly damaging Het
Tpcn2 T C 7: 145,268,869 T280A possibly damaging Het
Ttc23 A G 7: 67,711,366 I378V possibly damaging Het
Ttc29 A G 8: 78,325,576 D362G probably benign Het
Ttll7 A G 3: 146,940,162 I592V probably benign Het
Ugt3a1 A T 15: 9,306,086 H107L probably benign Het
Vmn1r70 A G 7: 10,633,903 Q87R probably damaging Het
Vmn2r-ps129 T C 17: 22,995,172 noncoding transcript Het
Wdfy4 G T 14: 33,146,990 S360R probably damaging Het
Zfp780b A G 7: 27,963,568 Y521H probably damaging Het
Other mutations in Plag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Plag1 APN 4 3904055 missense probably damaging 0.99
IGL01775:Plag1 APN 4 3904513 missense probably damaging 1.00
IGL02738:Plag1 APN 4 3903812 nonsense probably null
Rehab UTSW 4 3904546 missense probably damaging 1.00
scrawny UTSW 4 3905463 nonsense probably null
PIT4378001:Plag1 UTSW 4 3905492 missense probably benign 0.16
R0217:Plag1 UTSW 4 3904379 missense probably benign 0.05
R0359:Plag1 UTSW 4 3904546 missense probably damaging 1.00
R0554:Plag1 UTSW 4 3904546 missense probably damaging 1.00
R0892:Plag1 UTSW 4 3904532 nonsense probably null
R1541:Plag1 UTSW 4 3904085 missense probably benign
R1964:Plag1 UTSW 4 3903956 missense probably benign
R2011:Plag1 UTSW 4 3904889 missense probably damaging 1.00
R2012:Plag1 UTSW 4 3904870 missense probably damaging 1.00
R2126:Plag1 UTSW 4 3904169 missense possibly damaging 0.50
R3982:Plag1 UTSW 4 3904055 missense probably damaging 0.97
R4285:Plag1 UTSW 4 3905654 missense probably benign 0.13
R5244:Plag1 UTSW 4 3903887 missense probably benign 0.02
R5289:Plag1 UTSW 4 3905545 missense probably damaging 1.00
R5386:Plag1 UTSW 4 3904075 missense probably benign
R5428:Plag1 UTSW 4 3905538 missense possibly damaging 0.94
R5608:Plag1 UTSW 4 3905463 nonsense probably null
R5755:Plag1 UTSW 4 3904492 missense possibly damaging 0.94
R6036:Plag1 UTSW 4 3904618 missense possibly damaging 0.94
R6080:Plag1 UTSW 4 3903815 missense probably benign
R6296:Plag1 UTSW 4 3904499 missense probably damaging 1.00
R7038:Plag1 UTSW 4 3904676 missense probably damaging 1.00
R7116:Plag1 UTSW 4 3904812 nonsense probably null
R8435:Plag1 UTSW 4 3905648 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGACCGGCAGGAGTTCATC -3'
(R):5'- TGGTTTTAAGCGACACTTGGCC -3'

Sequencing Primer
(F):5'- GCAGGAGTTCATCTTTTATAGGCAC -3'
(R):5'- GACACTTGGCCTTGCATGCTG -3'
Posted On2017-08-16