Incidental Mutation 'R6036:Skint8'
ID486565
Institutional Source Beutler Lab
Gene Symbol Skint8
Ensembl Gene ENSMUSG00000078599
Gene Nameselection and upkeep of intraepithelial T cells 8
SynonymsOTTMUSG00000009475
MMRRC Submission 043257-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6036 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location111919392-111950358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 111950193 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 359 (L359M)
Ref Sequence ENSEMBL: ENSMUSP00000133268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165046]
Predicted Effect probably damaging
Transcript: ENSMUST00000165046
AA Change: L359M

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133268
Gene: ENSMUSG00000078599
AA Change: L359M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 3.13e-5 SMART
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 285 307 N/A INTRINSIC
transmembrane domain 327 352 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 T C 11: 95,832,858 probably benign Het
Ago1 C T 4: 126,443,228 R228H probably damaging Het
Alpk3 G A 7: 81,093,257 V941M probably benign Het
Ano4 A G 10: 88,982,265 W588R possibly damaging Het
Atp6v1a A G 16: 44,098,831 Y464H probably benign Het
Barx2 A T 9: 31,913,008 D28E probably damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Col10a1 A G 10: 34,395,282 T417A probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eif4enif1 T C 11: 3,239,420 S227P probably damaging Het
Erv3 G A 2: 131,856,005 H145Y possibly damaging Het
Exoc5 T C 14: 49,014,322 T591A possibly damaging Het
F5 A T 1: 164,184,996 E493V probably damaging Het
Gm8444 G T 15: 81,843,593 probably benign Het
Gria4 T A 9: 4,537,646 I221L probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hc T C 2: 35,039,684 T249A probably benign Het
Herc2 A G 7: 56,068,053 T48A probably benign Het
Hist1h2bl A T 13: 21,715,978 S56T probably damaging Het
Hp A G 8: 109,576,774 probably null Het
Ifna15 T G 4: 88,558,073 D58A possibly damaging Het
Kcnj1 A T 9: 32,397,125 M262L probably benign Het
Krt83 A C 15: 101,487,531 I320S possibly damaging Het
Megf10 A G 18: 57,242,727 N242D probably damaging Het
Nup155 A G 15: 8,128,411 T451A probably benign Het
Olfr1277 C T 2: 111,269,612 G252R probably damaging Het
Olfr1288 T C 2: 111,478,988 L68P probably damaging Het
Olfr559 T A 7: 102,724,485 I2F probably benign Het
Olfr701 A T 7: 106,818,460 I126F probably damaging Het
Olfr930 A G 9: 38,930,920 I250V probably damaging Het
Pdzd8 G A 19: 59,305,209 P403S probably damaging Het
Piezo2 G A 18: 63,114,948 Q494* probably null Het
Pik3c2b T C 1: 133,090,713 F966S possibly damaging Het
Plag1 T C 4: 3,904,618 E191G possibly damaging Het
Pou4f2 A T 8: 78,435,474 S167T probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scd4 G A 19: 44,344,792 D319N probably damaging Het
Senp2 A T 16: 22,028,558 R279* probably null Het
Sh3rf3 G A 10: 58,813,984 G137D probably benign Het
Simc1 C T 13: 54,524,621 P261S probably benign Het
Slc26a1 T A 5: 108,673,570 D151V probably damaging Het
Snx29 A G 16: 11,738,437 probably null Het
Stard9 C T 2: 120,700,075 A2271V probably benign Het
Stat6 A G 10: 127,655,444 N485D possibly damaging Het
Tpcn2 T C 7: 145,268,869 T280A possibly damaging Het
Ttc23 A G 7: 67,711,366 I378V possibly damaging Het
Ttc29 A G 8: 78,325,576 D362G probably benign Het
Ttll7 A G 3: 146,940,162 I592V probably benign Het
Ugt3a1 A T 15: 9,306,086 H107L probably benign Het
Vmn1r70 A G 7: 10,633,903 Q87R probably damaging Het
Vmn2r-ps129 T C 17: 22,995,172 noncoding transcript Het
Wdfy4 G T 14: 33,146,990 S360R probably damaging Het
Zfp780b A G 7: 27,963,568 Y521H probably damaging Het
Other mutations in Skint8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Skint8 APN 4 111938923 missense probably benign 0.05
IGL01411:Skint8 APN 4 111936906 missense probably damaging 0.97
IGL02973:Skint8 APN 4 111939593 missense probably benign 0.09
IGL03154:Skint8 APN 4 111939510 splice site probably null
FR4976:Skint8 UTSW 4 111938902 missense probably benign 0.02
R0309:Skint8 UTSW 4 111938867 missense probably benign 0.02
R0448:Skint8 UTSW 4 111936890 missense probably damaging 1.00
R0483:Skint8 UTSW 4 111938823 splice site probably benign
R0586:Skint8 UTSW 4 111936929 missense probably damaging 1.00
R1076:Skint8 UTSW 4 111927219 missense probably damaging 1.00
R1169:Skint8 UTSW 4 111928513 missense possibly damaging 0.86
R1588:Skint8 UTSW 4 111928727 nonsense probably null
R1707:Skint8 UTSW 4 111939572 missense probably damaging 1.00
R1865:Skint8 UTSW 4 111936995 missense probably damaging 1.00
R1954:Skint8 UTSW 4 111950081 missense possibly damaging 0.54
R2147:Skint8 UTSW 4 111937077 missense probably damaging 1.00
R2896:Skint8 UTSW 4 111950136 missense probably null
R4945:Skint8 UTSW 4 111939608 missense probably damaging 0.96
R5019:Skint8 UTSW 4 111928648 missense probably damaging 0.99
R5281:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5284:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5289:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5309:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5310:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5588:Skint8 UTSW 4 111936892 missense probably benign 0.01
R5636:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5637:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5638:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5639:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5719:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5720:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5754:Skint8 UTSW 4 111950190 missense probably benign
R5850:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5855:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R6525:Skint8 UTSW 4 111928738 missense probably damaging 0.98
R6554:Skint8 UTSW 4 111927216 missense probably benign 0.35
R6578:Skint8 UTSW 4 111936962 missense probably benign 0.03
R6841:Skint8 UTSW 4 111928771 missense probably damaging 1.00
R7000:Skint8 UTSW 4 111937025 missense probably benign 0.16
R7317:Skint8 UTSW 4 111939520 missense possibly damaging 0.94
R7336:Skint8 UTSW 4 111939572 missense probably benign 0.32
R7412:Skint8 UTSW 4 111928561 missense probably benign 0.07
R7480:Skint8 UTSW 4 111928587 nonsense probably null
R8027:Skint8 UTSW 4 111928739 missense probably benign 0.36
R8204:Skint8 UTSW 4 111938893 missense probably benign 0.03
Z1177:Skint8 UTSW 4 111937054 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GACATTTGGTAGCATGCAAAGG -3'
(R):5'- TGCTTTCTGTGCTAGAAGACC -3'

Sequencing Primer
(F):5'- GTTGAACCTATAGTACACAATCTCAC -3'
(R):5'- TCTGTGCTAGAAGACCTAGGC -3'
Posted On2017-08-16