Incidental Mutation 'R6036:Gtf2h3'
ID486568
Institutional Source Beutler Lab
Gene Symbol Gtf2h3
Ensembl Gene ENSMUSG00000029387
Gene Namegeneral transcription factor IIH, polypeptide 3
Synonyms34kDa, BTF2, D5Ertd679e, 5033417D07Rik
MMRRC Submission 043257-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R6036 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location124579140-124597680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124584297 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 121 (T121I)
Ref Sequence ENSEMBL: ENSMUSP00000031333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031333]
Predicted Effect probably benign
Transcript: ENSMUST00000031333
AA Change: T121I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031333
Gene: ENSMUSG00000029387
AA Change: T121I

DomainStartEndE-ValueType
Pfam:Tfb4 8 287 2.1e-108 PFAM
low complexity region 299 306 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200670
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TFB4 family. The encoded protein is a subunit of the core-TFIIH basal transcription factor and localizes to the nucleus. The encoded protein is involved in RNA transcription by RNA polymerase II and nucleotide excision repair and associates with the Cdk-activating kinase complex. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 14. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 T C 11: 95,832,858 probably benign Het
Ago1 C T 4: 126,443,228 R228H probably damaging Het
Alpk3 G A 7: 81,093,257 V941M probably benign Het
Ano4 A G 10: 88,982,265 W588R possibly damaging Het
Atp6v1a A G 16: 44,098,831 Y464H probably benign Het
Barx2 A T 9: 31,913,008 D28E probably damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Col10a1 A G 10: 34,395,282 T417A probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eif4enif1 T C 11: 3,239,420 S227P probably damaging Het
Erv3 G A 2: 131,856,005 H145Y possibly damaging Het
Exoc5 T C 14: 49,014,322 T591A possibly damaging Het
F5 A T 1: 164,184,996 E493V probably damaging Het
Gm8444 G T 15: 81,843,593 probably benign Het
Gria4 T A 9: 4,537,646 I221L probably benign Het
Hc T C 2: 35,039,684 T249A probably benign Het
Herc2 A G 7: 56,068,053 T48A probably benign Het
Hist1h2bl A T 13: 21,715,978 S56T probably damaging Het
Hp A G 8: 109,576,774 probably null Het
Ifna15 T G 4: 88,558,073 D58A possibly damaging Het
Kcnj1 A T 9: 32,397,125 M262L probably benign Het
Krt83 A C 15: 101,487,531 I320S possibly damaging Het
Megf10 A G 18: 57,242,727 N242D probably damaging Het
Nup155 A G 15: 8,128,411 T451A probably benign Het
Olfr1277 C T 2: 111,269,612 G252R probably damaging Het
Olfr1288 T C 2: 111,478,988 L68P probably damaging Het
Olfr559 T A 7: 102,724,485 I2F probably benign Het
Olfr701 A T 7: 106,818,460 I126F probably damaging Het
Olfr930 A G 9: 38,930,920 I250V probably damaging Het
Pdzd8 G A 19: 59,305,209 P403S probably damaging Het
Piezo2 G A 18: 63,114,948 Q494* probably null Het
Pik3c2b T C 1: 133,090,713 F966S possibly damaging Het
Plag1 T C 4: 3,904,618 E191G possibly damaging Het
Pou4f2 A T 8: 78,435,474 S167T probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scd4 G A 19: 44,344,792 D319N probably damaging Het
Senp2 A T 16: 22,028,558 R279* probably null Het
Sh3rf3 G A 10: 58,813,984 G137D probably benign Het
Simc1 C T 13: 54,524,621 P261S probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc26a1 T A 5: 108,673,570 D151V probably damaging Het
Snx29 A G 16: 11,738,437 probably null Het
Stard9 C T 2: 120,700,075 A2271V probably benign Het
Stat6 A G 10: 127,655,444 N485D possibly damaging Het
Tpcn2 T C 7: 145,268,869 T280A possibly damaging Het
Ttc23 A G 7: 67,711,366 I378V possibly damaging Het
Ttc29 A G 8: 78,325,576 D362G probably benign Het
Ttll7 A G 3: 146,940,162 I592V probably benign Het
Ugt3a1 A T 15: 9,306,086 H107L probably benign Het
Vmn1r70 A G 7: 10,633,903 Q87R probably damaging Het
Vmn2r-ps129 T C 17: 22,995,172 noncoding transcript Het
Wdfy4 G T 14: 33,146,990 S360R probably damaging Het
Zfp780b A G 7: 27,963,568 Y521H probably damaging Het
Other mutations in Gtf2h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Gtf2h3 APN 5 124595668 missense probably damaging 0.96
IGL01611:Gtf2h3 APN 5 124595685 missense probably damaging 1.00
IGL01681:Gtf2h3 APN 5 124594791 missense probably damaging 1.00
IGL03097:Gtf2h3 UTSW 5 124602168 unclassified probably benign
R0599:Gtf2h3 UTSW 5 124588628 missense probably benign 0.00
R1512:Gtf2h3 UTSW 5 124590870 missense probably damaging 0.99
R1727:Gtf2h3 UTSW 5 124590356 missense probably benign 0.00
R1880:Gtf2h3 UTSW 5 124584273 missense probably benign 0.00
R1881:Gtf2h3 UTSW 5 124584273 missense probably benign 0.00
R1929:Gtf2h3 UTSW 5 124602199 unclassified probably benign
R2149:Gtf2h3 UTSW 5 124599785 unclassified probably benign
R2359:Gtf2h3 UTSW 5 124590876 missense probably damaging 1.00
R2993:Gtf2h3 UTSW 5 124583934 missense probably benign 0.00
R4399:Gtf2h3 UTSW 5 124602063 unclassified probably benign
R4551:Gtf2h3 UTSW 5 124590419 intron probably benign
R5282:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5289:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5566:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5567:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5569:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5570:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5581:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5583:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5709:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5784:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5967:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5968:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6050:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6518:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6519:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6520:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6526:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6528:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R7176:Gtf2h3 UTSW 5 124590370 missense probably damaging 0.99
R7184:Gtf2h3 UTSW 5 124584004 missense probably benign 0.22
R8262:Gtf2h3 UTSW 5 124590904 nonsense probably null
R8270:Gtf2h3 UTSW 5 124595987 makesense probably null
R8323:Gtf2h3 UTSW 5 124582471 missense probably benign 0.01
R8361:Gtf2h3 UTSW 5 124595668 missense probably damaging 0.96
Z1176:Gtf2h3 UTSW 5 124579175 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCCCTCAGCCGGCTCTTATA -3'
(R):5'- ACAAAGCTGGGAGGCATGTA -3'

Sequencing Primer
(F):5'- CTCTTATACCCGGGGAAGAACG -3'
(R):5'- CTGGGAGGCATGTAGGGAG -3'
Posted On2017-08-16