Incidental Mutation 'R6036:Tpcn2'
ID486578
Institutional Source Beutler Lab
Gene Symbol Tpcn2
Ensembl Gene ENSMUSG00000048677
Gene Nametwo pore segment channel 2
Synonyms
MMRRC Submission 043257-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6036 (G1)
Quality Score207.009
Status Not validated
Chromosome7
Chromosomal Location145186524-145284011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145268869 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 280 (T280A)
Ref Sequence ENSEMBL: ENSMUSP00000147178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058022] [ENSMUST00000208148] [ENSMUST00000208328] [ENSMUST00000208841] [ENSMUST00000209047]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058022
AA Change: T280A

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000061308
Gene: ENSMUSG00000048677
AA Change: T280A

DomainStartEndE-ValueType
Pfam:Ion_trans 67 302 5.1e-24 PFAM
Pfam:Ion_trans 415 683 1.5e-29 PFAM
low complexity region 709 729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208148
AA Change: T256A

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208328
AA Change: T280A

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208841
AA Change: T280A

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209047
AA Change: T280A

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative cation-selective ion channel with two repeats of a six-transmembrane-domain. The protein localizes to lysosomal membranes and enables nicotinic acid adenine dinucleotide phosphate (NAADP) -induced calcium ion release from lysosome-related stores. This ubiquitously expressed gene has elevated expression in liver and kidney. Two common nonsynonymous SNPs in this gene strongly associate with blond versus brown hair pigmentation.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit altered beta cell calcium ion physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 T C 11: 95,832,858 probably benign Het
Ago1 C T 4: 126,443,228 R228H probably damaging Het
Alpk3 G A 7: 81,093,257 V941M probably benign Het
Ano4 A G 10: 88,982,265 W588R possibly damaging Het
Atp6v1a A G 16: 44,098,831 Y464H probably benign Het
Barx2 A T 9: 31,913,008 D28E probably damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Col10a1 A G 10: 34,395,282 T417A probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eif4enif1 T C 11: 3,239,420 S227P probably damaging Het
Erv3 G A 2: 131,856,005 H145Y possibly damaging Het
Exoc5 T C 14: 49,014,322 T591A possibly damaging Het
F5 A T 1: 164,184,996 E493V probably damaging Het
Gm8444 G T 15: 81,843,593 probably benign Het
Gria4 T A 9: 4,537,646 I221L probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hc T C 2: 35,039,684 T249A probably benign Het
Herc2 A G 7: 56,068,053 T48A probably benign Het
Hist1h2bl A T 13: 21,715,978 S56T probably damaging Het
Hp A G 8: 109,576,774 probably null Het
Ifna15 T G 4: 88,558,073 D58A possibly damaging Het
Kcnj1 A T 9: 32,397,125 M262L probably benign Het
Krt83 A C 15: 101,487,531 I320S possibly damaging Het
Megf10 A G 18: 57,242,727 N242D probably damaging Het
Nup155 A G 15: 8,128,411 T451A probably benign Het
Olfr1277 C T 2: 111,269,612 G252R probably damaging Het
Olfr1288 T C 2: 111,478,988 L68P probably damaging Het
Olfr559 T A 7: 102,724,485 I2F probably benign Het
Olfr701 A T 7: 106,818,460 I126F probably damaging Het
Olfr930 A G 9: 38,930,920 I250V probably damaging Het
Pdzd8 G A 19: 59,305,209 P403S probably damaging Het
Piezo2 G A 18: 63,114,948 Q494* probably null Het
Pik3c2b T C 1: 133,090,713 F966S possibly damaging Het
Plag1 T C 4: 3,904,618 E191G possibly damaging Het
Pou4f2 A T 8: 78,435,474 S167T probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scd4 G A 19: 44,344,792 D319N probably damaging Het
Senp2 A T 16: 22,028,558 R279* probably null Het
Sh3rf3 G A 10: 58,813,984 G137D probably benign Het
Simc1 C T 13: 54,524,621 P261S probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc26a1 T A 5: 108,673,570 D151V probably damaging Het
Snx29 A G 16: 11,738,437 probably null Het
Stard9 C T 2: 120,700,075 A2271V probably benign Het
Stat6 A G 10: 127,655,444 N485D possibly damaging Het
Ttc23 A G 7: 67,711,366 I378V possibly damaging Het
Ttc29 A G 8: 78,325,576 D362G probably benign Het
Ttll7 A G 3: 146,940,162 I592V probably benign Het
Ugt3a1 A T 15: 9,306,086 H107L probably benign Het
Vmn1r70 A G 7: 10,633,903 Q87R probably damaging Het
Vmn2r-ps129 T C 17: 22,995,172 noncoding transcript Het
Wdfy4 G T 14: 33,146,990 S360R probably damaging Het
Zfp780b A G 7: 27,963,568 Y521H probably damaging Het
Other mutations in Tpcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Tpcn2 APN 7 145267378 missense probably damaging 1.00
IGL02112:Tpcn2 APN 7 145256792 missense probably benign 0.18
IGL02646:Tpcn2 APN 7 145258574 missense probably benign 0.03
R0385:Tpcn2 UTSW 7 145277174 missense probably damaging 1.00
R1441:Tpcn2 UTSW 7 145260134 missense probably benign
R1498:Tpcn2 UTSW 7 145268911 missense probably damaging 1.00
R1598:Tpcn2 UTSW 7 145277220 nonsense probably null
R2127:Tpcn2 UTSW 7 145273975 splice site probably benign
R2354:Tpcn2 UTSW 7 145257218 missense probably damaging 1.00
R3747:Tpcn2 UTSW 7 145255523 missense probably damaging 0.97
R3748:Tpcn2 UTSW 7 145255523 missense probably damaging 0.97
R3749:Tpcn2 UTSW 7 145255523 missense probably damaging 0.97
R4775:Tpcn2 UTSW 7 145267342 missense probably damaging 1.00
R4835:Tpcn2 UTSW 7 145272351 missense probably damaging 0.98
R4931:Tpcn2 UTSW 7 145267309 missense probably benign 0.34
R4979:Tpcn2 UTSW 7 145260096 missense probably benign
R5185:Tpcn2 UTSW 7 145255454 missense probably damaging 1.00
R5418:Tpcn2 UTSW 7 145278781 missense probably damaging 1.00
R5443:Tpcn2 UTSW 7 145255472 missense possibly damaging 0.46
R5623:Tpcn2 UTSW 7 145267334 missense possibly damaging 0.76
R5716:Tpcn2 UTSW 7 145257813 missense possibly damaging 0.94
R5910:Tpcn2 UTSW 7 145260982 missense probably benign 0.01
R5927:Tpcn2 UTSW 7 145278784 missense probably damaging 0.99
R6015:Tpcn2 UTSW 7 145266851 missense probably damaging 1.00
R6036:Tpcn2 UTSW 7 145268869 missense possibly damaging 0.93
R6299:Tpcn2 UTSW 7 145262243 missense probably damaging 1.00
R6337:Tpcn2 UTSW 7 145279343 missense probably damaging 1.00
R6382:Tpcn2 UTSW 7 145269749 missense possibly damaging 0.88
R6724:Tpcn2 UTSW 7 145256520 missense probably benign 0.00
R6995:Tpcn2 UTSW 7 145256785 missense probably benign 0.00
R7494:Tpcn2 UTSW 7 145278849 missense possibly damaging 0.91
R7942:Tpcn2 UTSW 7 145257191 missense probably damaging 0.99
R8052:Tpcn2 UTSW 7 145260946 missense probably benign 0.06
R8320:Tpcn2 UTSW 7 145266622 missense possibly damaging 0.75
Y4335:Tpcn2 UTSW 7 145257235 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCAAGGTCCAGTTAAAGGG -3'
(R):5'- CAGGCAGTACTGTAAGGGTTTG -3'

Sequencing Primer
(F):5'- CCAAGGTCCAGTTAAAGGGAGTTG -3'
(R):5'- TTGAGGTTGGACTTTGAACAGGAAG -3'
Posted On2017-08-16