Incidental Mutation 'R6036:Hist1h2bl'
ID486593
Institutional Source Beutler Lab
Gene Symbol Hist1h2bl
Ensembl Gene ENSMUSG00000094338
Gene Namehistone cluster 1, H2bl
Synonyms
MMRRC Submission 043257-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6036 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location21715763-21716143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21715978 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 56 (S56T)
Ref Sequence ENSEMBL: ENSMUSP00000089350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070124] [ENSMUST00000091756] [ENSMUST00000188775]
Predicted Effect probably benign
Transcript: ENSMUST00000070124
SMART Domains Protein: ENSMUSP00000088285
Gene: ENSMUSG00000071516

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091756
AA Change: S56T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000089350
Gene: ENSMUSG00000094338
AA Change: S56T

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188775
SMART Domains Protein: ENSMUSP00000140394
Gene: ENSMUSG00000101355

DomainStartEndE-ValueType
H3 34 136 1.5e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196836
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 T C 11: 95,832,858 probably benign Het
Ago1 C T 4: 126,443,228 R228H probably damaging Het
Alpk3 G A 7: 81,093,257 V941M probably benign Het
Ano4 A G 10: 88,982,265 W588R possibly damaging Het
Atp6v1a A G 16: 44,098,831 Y464H probably benign Het
Barx2 A T 9: 31,913,008 D28E probably damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Col10a1 A G 10: 34,395,282 T417A probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eif4enif1 T C 11: 3,239,420 S227P probably damaging Het
Erv3 G A 2: 131,856,005 H145Y possibly damaging Het
Exoc5 T C 14: 49,014,322 T591A possibly damaging Het
F5 A T 1: 164,184,996 E493V probably damaging Het
Gm8444 G T 15: 81,843,593 probably benign Het
Gria4 T A 9: 4,537,646 I221L probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hc T C 2: 35,039,684 T249A probably benign Het
Herc2 A G 7: 56,068,053 T48A probably benign Het
Hp A G 8: 109,576,774 probably null Het
Ifna15 T G 4: 88,558,073 D58A possibly damaging Het
Kcnj1 A T 9: 32,397,125 M262L probably benign Het
Krt83 A C 15: 101,487,531 I320S possibly damaging Het
Megf10 A G 18: 57,242,727 N242D probably damaging Het
Nup155 A G 15: 8,128,411 T451A probably benign Het
Olfr1277 C T 2: 111,269,612 G252R probably damaging Het
Olfr1288 T C 2: 111,478,988 L68P probably damaging Het
Olfr559 T A 7: 102,724,485 I2F probably benign Het
Olfr701 A T 7: 106,818,460 I126F probably damaging Het
Olfr930 A G 9: 38,930,920 I250V probably damaging Het
Pdzd8 G A 19: 59,305,209 P403S probably damaging Het
Piezo2 G A 18: 63,114,948 Q494* probably null Het
Pik3c2b T C 1: 133,090,713 F966S possibly damaging Het
Plag1 T C 4: 3,904,618 E191G possibly damaging Het
Pou4f2 A T 8: 78,435,474 S167T probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scd4 G A 19: 44,344,792 D319N probably damaging Het
Senp2 A T 16: 22,028,558 R279* probably null Het
Sh3rf3 G A 10: 58,813,984 G137D probably benign Het
Simc1 C T 13: 54,524,621 P261S probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc26a1 T A 5: 108,673,570 D151V probably damaging Het
Snx29 A G 16: 11,738,437 probably null Het
Stard9 C T 2: 120,700,075 A2271V probably benign Het
Stat6 A G 10: 127,655,444 N485D possibly damaging Het
Tpcn2 T C 7: 145,268,869 T280A possibly damaging Het
Ttc23 A G 7: 67,711,366 I378V possibly damaging Het
Ttc29 A G 8: 78,325,576 D362G probably benign Het
Ttll7 A G 3: 146,940,162 I592V probably benign Het
Ugt3a1 A T 15: 9,306,086 H107L probably benign Het
Vmn1r70 A G 7: 10,633,903 Q87R probably damaging Het
Vmn2r-ps129 T C 17: 22,995,172 noncoding transcript Het
Wdfy4 G T 14: 33,146,990 S360R probably damaging Het
Zfp780b A G 7: 27,963,568 Y521H probably damaging Het
Other mutations in Hist1h2bl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Hist1h2bl APN 13 21715894 missense probably damaging 1.00
R0482:Hist1h2bl UTSW 13 21716125 unclassified probably benign
R1341:Hist1h2bl UTSW 13 21716110 missense probably benign 0.09
R1355:Hist1h2bl UTSW 13 21715857 missense probably damaging 1.00
R4793:Hist1h2bl UTSW 13 21715918 missense probably benign 0.00
R4816:Hist1h2bl UTSW 13 21715965 missense probably benign 0.32
R4842:Hist1h2bl UTSW 13 21716064 unclassified probably benign
R4917:Hist1h2bl UTSW 13 21716019 missense probably damaging 0.97
R5355:Hist1h2bl UTSW 13 21715860 missense probably damaging 1.00
R6036:Hist1h2bl UTSW 13 21715978 missense probably damaging 0.99
R7546:Hist1h2bl UTSW 13 21715870 missense probably benign 0.19
R7972:Hist1h2bl UTSW 13 21715807 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CTCACTTGGAGCTGGTGTAC -3'
(R):5'- GATTCAGGTTCGGCATAGCC -3'

Sequencing Primer
(F):5'- TTGGTGCCCTCCGACAC -3'
(R):5'- GCCGTAAGTTTGTTTAAAATGCAGCC -3'
Posted On2017-08-16