Incidental Mutation 'R6036:Senp2'
ID486601
Institutional Source Beutler Lab
Gene Symbol Senp2
Ensembl Gene ENSMUSG00000022855
Gene NameSUMO/sentrin specific peptidase 2
Synonyms4930538C18Rik, 2310007L05Rik
MMRRC Submission 043257-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6036 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location22009484-22049269 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 22028558 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 279 (R279*)
Ref Sequence ENSEMBL: ENSMUSP00000023561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023561] [ENSMUST00000231724] [ENSMUST00000232534] [ENSMUST00000232679]
Predicted Effect probably null
Transcript: ENSMUST00000023561
AA Change: R279*
SMART Domains Protein: ENSMUSP00000023561
Gene: ENSMUSG00000022855
AA Change: R279*

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 101 118 N/A INTRINSIC
low complexity region 325 340 N/A INTRINSIC
Pfam:Peptidase_C48 408 587 1.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231724
Predicted Effect probably benign
Transcript: ENSMUST00000231798
Predicted Effect probably benign
Transcript: ENSMUST00000232263
Predicted Effect probably benign
Transcript: ENSMUST00000232534
Predicted Effect probably benign
Transcript: ENSMUST00000232679
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SUMO1 (UBL1; MIM 601912) is a small ubiquitin-like protein that can be covalently conjugated to other proteins. SENP2 is one of a group of enzymes that process newly synthesized SUMO1 into the conjugatable form and catalyze the deconjugation of SUMO1-containing species.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygous null mice are embryonic lethal due to placental defects resulting from abnormal trophoblast maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 T C 11: 95,832,858 probably benign Het
Ago1 C T 4: 126,443,228 R228H probably damaging Het
Alpk3 G A 7: 81,093,257 V941M probably benign Het
Ano4 A G 10: 88,982,265 W588R possibly damaging Het
Atp6v1a A G 16: 44,098,831 Y464H probably benign Het
Barx2 A T 9: 31,913,008 D28E probably damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Col10a1 A G 10: 34,395,282 T417A probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eif4enif1 T C 11: 3,239,420 S227P probably damaging Het
Erv3 G A 2: 131,856,005 H145Y possibly damaging Het
Exoc5 T C 14: 49,014,322 T591A possibly damaging Het
F5 A T 1: 164,184,996 E493V probably damaging Het
Gm8444 G T 15: 81,843,593 probably benign Het
Gria4 T A 9: 4,537,646 I221L probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hc T C 2: 35,039,684 T249A probably benign Het
Herc2 A G 7: 56,068,053 T48A probably benign Het
Hist1h2bl A T 13: 21,715,978 S56T probably damaging Het
Hp A G 8: 109,576,774 probably null Het
Ifna15 T G 4: 88,558,073 D58A possibly damaging Het
Kcnj1 A T 9: 32,397,125 M262L probably benign Het
Krt83 A C 15: 101,487,531 I320S possibly damaging Het
Megf10 A G 18: 57,242,727 N242D probably damaging Het
Nup155 A G 15: 8,128,411 T451A probably benign Het
Olfr1277 C T 2: 111,269,612 G252R probably damaging Het
Olfr1288 T C 2: 111,478,988 L68P probably damaging Het
Olfr559 T A 7: 102,724,485 I2F probably benign Het
Olfr701 A T 7: 106,818,460 I126F probably damaging Het
Olfr930 A G 9: 38,930,920 I250V probably damaging Het
Pdzd8 G A 19: 59,305,209 P403S probably damaging Het
Piezo2 G A 18: 63,114,948 Q494* probably null Het
Pik3c2b T C 1: 133,090,713 F966S possibly damaging Het
Plag1 T C 4: 3,904,618 E191G possibly damaging Het
Pou4f2 A T 8: 78,435,474 S167T probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scd4 G A 19: 44,344,792 D319N probably damaging Het
Sh3rf3 G A 10: 58,813,984 G137D probably benign Het
Simc1 C T 13: 54,524,621 P261S probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc26a1 T A 5: 108,673,570 D151V probably damaging Het
Snx29 A G 16: 11,738,437 probably null Het
Stard9 C T 2: 120,700,075 A2271V probably benign Het
Stat6 A G 10: 127,655,444 N485D possibly damaging Het
Tpcn2 T C 7: 145,268,869 T280A possibly damaging Het
Ttc23 A G 7: 67,711,366 I378V possibly damaging Het
Ttc29 A G 8: 78,325,576 D362G probably benign Het
Ttll7 A G 3: 146,940,162 I592V probably benign Het
Ugt3a1 A T 15: 9,306,086 H107L probably benign Het
Vmn1r70 A G 7: 10,633,903 Q87R probably damaging Het
Vmn2r-ps129 T C 17: 22,995,172 noncoding transcript Het
Wdfy4 G T 14: 33,146,990 S360R probably damaging Het
Zfp780b A G 7: 27,963,568 Y521H probably damaging Het
Other mutations in Senp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Senp2 APN 16 22018364 missense probably damaging 1.00
IGL01562:Senp2 APN 16 22009687 missense probably damaging 1.00
IGL01757:Senp2 APN 16 22009664 missense probably benign 0.13
IGL02593:Senp2 APN 16 22044271 missense probably damaging 1.00
IGL02896:Senp2 APN 16 22018368 nonsense probably null
IGL03219:Senp2 APN 16 22014264 splice site probably benign
IGL03244:Senp2 APN 16 22040579 missense probably damaging 0.97
wrestler UTSW 16 22038622 missense probably damaging 1.00
PIT1430001:Senp2 UTSW 16 22014114 splice site probably benign
R0410:Senp2 UTSW 16 22009694 missense probably damaging 0.99
R0511:Senp2 UTSW 16 22036570 missense probably benign 0.01
R1186:Senp2 UTSW 16 22011504 missense probably damaging 0.99
R1689:Senp2 UTSW 16 22026666 missense probably damaging 0.98
R1723:Senp2 UTSW 16 22028042 missense probably benign 0.00
R1776:Senp2 UTSW 16 22043060 splice site probably benign
R2056:Senp2 UTSW 16 22014199 missense probably damaging 1.00
R2058:Senp2 UTSW 16 22014199 missense probably damaging 1.00
R2371:Senp2 UTSW 16 22018375 missense possibly damaging 0.86
R3838:Senp2 UTSW 16 22009735 missense probably damaging 0.99
R3839:Senp2 UTSW 16 22009735 missense probably damaging 0.99
R4001:Senp2 UTSW 16 22028568 missense possibly damaging 0.95
R4190:Senp2 UTSW 16 22046667 missense probably damaging 1.00
R4191:Senp2 UTSW 16 22046667 missense probably damaging 1.00
R4193:Senp2 UTSW 16 22046667 missense probably damaging 1.00
R4231:Senp2 UTSW 16 22011554 critical splice donor site probably null
R4435:Senp2 UTSW 16 22014241 missense possibly damaging 0.83
R4847:Senp2 UTSW 16 22038636 missense possibly damaging 0.90
R5207:Senp2 UTSW 16 22041380 missense possibly damaging 0.52
R5509:Senp2 UTSW 16 22040522 missense probably damaging 1.00
R6036:Senp2 UTSW 16 22028558 nonsense probably null
R6475:Senp2 UTSW 16 22023800 missense probably damaging 1.00
R6517:Senp2 UTSW 16 22026724 missense possibly damaging 0.95
R6923:Senp2 UTSW 16 22011576 intron probably benign
R7287:Senp2 UTSW 16 22018364 missense probably damaging 1.00
R7747:Senp2 UTSW 16 22038622 missense probably damaging 1.00
R7884:Senp2 UTSW 16 22014231 missense probably benign 0.39
R8037:Senp2 UTSW 16 22014138 nonsense probably null
R8393:Senp2 UTSW 16 22032114 missense probably damaging 0.99
Z1177:Senp2 UTSW 16 22009705 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGCTTATGGAATGAACTGGTATCAG -3'
(R):5'- GCCCAACTTAAGAACTATTCGC -3'

Sequencing Primer
(F):5'- CAGTTGTGCTCAGGATTTAAGGAAG -3'
(R):5'- AGAACTATTCGCTTATTCCTGAGTGC -3'
Posted On2017-08-16